Table 2.

Primers for real-time RT-PCR

mRNASense PrimerAntisense Primer
PGC-1αTCAGACCTGACACAACACGGACATCAAGAGCAGCAAAAGCATCACA
GAPDHCCTCCTGCACCACCAACTGCTTGAGGGGCCATCCACAGTCTTCT
RPLP0GGAAACTCTGCATTCTCGCTTCCTCCAGGACTCGTTTGTACCCGTTGM