J Appl Physiol 98: 2381-2389, 2005.
First published January 27, 2005; doi:10.1152/japplphysiol.01073.2004
8750-7587/05 $8.00
HIGHLIGHTED TOPICS
Biomechanics and Mechanotransduction in Cells and Tissues
Weight loading young chicks inhibits bone elongation and promotes growth plate ossification and vascularization
A. Reich,1,2
N. Jaffe,3
A. Tong,1
I. Lavelin,1
O. Genina,1
M. Pines,1
D. Sklan,2
A. Nussinovitch,3 and
E. Monsonego-Ornan1
1Institute of Animal Science, the Volcani Center, Bet Dagan; 2Department of Animal Science, and 3Department of Biochemistry, The Faculty of Agricultural, Food and Environmental Quality Sciences, The Hebrew University of Jerusalem, Rehovot, Israel
Submitted 28 September 2004
; accepted in final form 25 January 2005
 |
ABSTRACT
|
|---|
The mechanical stimuli resulting from weight loading play an important role in mature bone remodeling. However, the effect of weight loading on the developmental process in young bones is less well understood. In this work, chicks were loaded with bags weighing 10% of their body weight during their rapid growth phase. The increased load reduced the length and diameter of the long bones. The average width of the bag-loaded group's growth plates was 75 ± 4% that of the controls, and the plates showed increased mineralization. Northern blot analysis, in situ hybridization, and longitudinal cell counting of mechanically loaded growth plates showed narrowed expression zones of collagen types II and X compared with controls, with no differences between the relative proportions of those areas. An increase in osteopontin (OPN) expression with loading was most pronounced at the bone-cartilage interface. This extended expression overlapped with tartarate-resistant acid phosphatase staining and with the front of the mineralized matrix in the chondro-osseous junction. Moreover, weight loading enhanced the penetration of blood vessels into the growth plates and enhanced the gene expression of the matrix metalloproteinases MMP9 and MMP13 in those growth plates. On the basis of these results, we speculate that the mechanical strain on the chondrocytes in the growth plate causes overexpression of OPN, MMP9, and MMP13. The MMPs enable penetration of the blood vessels, which carry osteoclasts and osteoblasts. OPN recruits the osteoclasts to the cartilage-bone border, thus accelerating cartilage resorption in this zone and subsequent ossification which, in turn, contributes to the observed phenotype of narrower growth plate and shorter bones.
osteoclasts; chondrocytes; cartilage; matrix metalloproteinases
MECHANICAL FORCES PLAY A CRITICAL role in physiological processes such as bone formation and remodeling, angiogenesis, etc. (28, 36), and hyperphysiological strain has clinical consequences (62, 64). Mechanical stimuli resulting from weight loading and muscle contraction play an important role in remodeling the mature bone. Skeletal unloading as a result of prolonged bed rest, paralysis, or extended periods of weightlessness (as in spaceflight) leads to the rapid loss of bone mass (47). Hence, the application of mechanical force is one of the major treatments for osteoporosis. This adaptive remodeling is regulated by the activities of osteoblasts and osteoclasts, which sense their mechanical environments and regulate deposition or resorption of the bone matrix accordingly (16). However, numerous reports have shown inconsistent effects of weightlessness on longitudinal bone growth: it can inhibit bone formation (35), have no effect at all on bone size (46), or suppress bone enlargement (37, 42, 52, 58). The reported effects of excess loading, as in the case of competitive athletes, are also contradictory, showing induction or reduction of longitudinal growth, most likely due to variations in the type and rate of the physical activity (5, 27, 49).
The process of bone elongation occurs via the development of cartilage rather than bone (endochondral ossification) (6). The cartilage (produced by the chondrocytes) is calcified and degraded by the invasion of osteoclasts, and a typical osseous tissue is formed in the epiphyseal growth plate (13). Chondrocytes localized in the different regions of the growth plate differ in their morphology, proliferation abilities, and secretion of unique extracellular matrix (ECM) components. Synthesis of collagen type II (Col II) is characteristic of chondrocytes in the proliferative state whereas that of collagen type X (Col X) is restricted to the hypertrophic state (24, 33). The rate of bone elongation is regulated by the rate of chondrocyte proliferation and differentiation on one side of the growth plate and by blood vessel penetration and cartilage resorption at the border of the plate and at the metaphyseal bone on the opposite side (3, 9, 17).
Osteoclasts are the main cell type responsible for the process of cartilage resorption during ossification. Together with endothelial cells, they migrate and invade the calcified cartilage. The osteoclasts adhere in an
V
3-dependent manner to the RGD (arginine-glycine-aspartic acid) domain that is present in many ECM proteins, including vitronectin and osteopontin (OPN). OPN, a secreted phosphoprotein, is an abundant noncollagenous protein that is produced by chondrocytes, osteoblasts, and osteoclasts (38, 41, 45) and contains RGD sequences, which support adhesion of bone cells to the mineralized matrix via integrins (12, 31, 39). Vascularization of the growth plate region is a key mechanism in the coupling of two processes that determine the rate of bone growth: chondrogenesis and osteogenesis. Vascular invasion occurs in the ECM surrounding the hypertrophic chondrocyte and involves matrix degradation by the matrix metalloproteinases (MMPs) secreted by chondroclasts, osteoclasts, and endothelial cells (4, 13). The MMPs are a large family of zinc-dependent proteases that have been implicated in physiological and pathological processes in the growth plate (60). MMP9, also called gelatinase (Gel) B, has been found to be crucial in growth plate vascularization and ossification (61). Mutation in the human MMP2, gelatinase A, causes a multicentric osteolysis and arthritis syndrome phenotype, which results from an imbalance between bone synthesis and resorption (29). MMP13 is expressed by osteoblasts and chondrocytes during embryogenesis (25) and has recently been found to alter endochondral bone development (51).
Many different stresses or strains have been applied to bone-derived cells to examine their response to mechanical stimulation in vitro (30, 55). For example, intermittent hydrostatic compression of calvarial bone cells enhanced the expression of bone-specific genes such as alkaline phosphatase, procollagen type I, and OPN (44). Furthermore, a positive correlation between mechanical strain induction and OPN gene expression was manifested in different systems in vivo (24, 54) and in vitro (14, 20, 22, 55). Mechanical stretching of cultured osteoclasts revealed alterations in osteoclastic resorption and in the expressions of the osteoclast-specific enzymes tartarate-resistant acid phosphatase (TRAP) and cathepsin K (23).
The present study addresses the effect of mild mechanical loading on bone elongation in fast-growing young chicks to evaluate the effect of weight loading on differentiation, mineralization, and ossification. We harnessed the loads onto the chicks without surgical procedures or dramatic alterations in their environmental conditions and then performed morphological and histological studies of their growth plates to reveal new data concerning the effect of mechanical loading at an early age, before sexual maturation, on bone growth. The significance of mechanical stress studies on bones in their rapid elongation phase could be relevant to intense sports activities during adolescence, the act of bearing heavy loads, and possibly childhood obesity.
 |
MATERIALS AND METHODS
|
|---|
Animals and loading treatment.
One-day-old broiler chicks (Cobb) were obtained from a commercial hatchery (Brown Hatcheries, Hod Hasharon, Israel), raised in constant-temperature battery brooders at 34°C, and fed an age-appropriate diet, according to National Research Council recommendations, ad libitum. The chicks were divided into four groups, and after 2 days of adaptation, the experiment was begun. Sand-containing bags (2.5 x 4 cm) weighing 6 g each, i.e.,
10% of the chick's body weight (BW), were harnessed onto chicks in two groups (Bag 2d and Bag 4d) for 2 or 4 days, respectively. The weights were held on the chicks' backs by means of an elasticized-cloth harness, which was slipped around the body in an X shape. All procedures were approved by the Animal Care Welfare Committee of our Institute. Chicks raised under the same conditions, but without the weights, served as controls (groups Ctrl 2d and Ctrl 4d). Chicks in a fifth group (Sad) were fitted with a saddle of similar construction as the harness, but weighing 1% of the chick's BW, which was kept on for 4 days; a sixth group (PF) consisted of chicks that were pair fed for comparison with the Bag 4d group. BW and feed consumption were measured daily. Feed efficiency was calculated by dividing weight gain by feed consumption.
At the end of the treatment periods, tibia and femur were removed, and their lengths and diameters (in the ML direction) were measured with calipers. Four different diameter measurements were performed on each bone; the average is presented. Proximal tibia samples were processed for histology or RNA isolation. The width of the growth plates and number of longitudinal cells were measured at three different points along the plate center, averaged for each plate, and then averaged with measurements from other plate samples. The RNA samples were prepared from pools of growth plates to obtain sufficient amounts for Northern blot analysis. Three identical, independent experiments were performed with the four groups: Ctrl 2d, Ctrl 4d, Bag 2d, and Bag 4d, 15 chicks per group. The Sad group was added to the first experiment (15 chicks) as a control, and the PF group was added to the second experiment (10 chicks) to verify the effect of feed consumption on bone and growth plate sizes. The chicks from the first and second experiments were used for BW determinations, and their bones were taken for measurements and histology; the bones from the second and third experiments were used for pooled RNA preparation and histology. Thus histology was analyzed in all three experiments, and BW was recorded, bone measurements were taken, and RNA was pooled from two experiments.
RNA isolation and Northern blot analysis.
To prepare the RNA, proximal tibia growth plates were isolated, crushed into tiny pieces, and treated with collagenase for 1 h at 37°C. RNA was prepared with TRI Reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer's protocol, with modifications for samples rich in glycoproteins. Total RNA was extracted, and 10 µg of growth plate RNA were subjected to Northern blot analysis. The RNA blots were hybridized with 32P-labeled (CTP 6000 Ci/mmol, Radiochemical Centre, Amersham) cDNA probes of OPN, Col II, Col X, MMP2/Gel A, MMP9/Gel B, and MMP13 in hybridization buffer (Biochemical Industries, Bet-Haemek, Israel) (34) at 68°C. Densitometric analysis of the Northern blots was performed on the presented data to neutralize the differences in the amounts of RNA per lane. The presented blot is characteristic of those from three separate experiments, which all yielded the same pattern. Each lane contains pooled RNA from 20 growth plates, thus representing average levels for each treatment.
Histological staining, in situ hybridization, and immunohistochemistry of growth plate sections.
Growth plates were fixed overnight in 4% paraformaldehyde in PBS at 4°C. The samples were dehydrated in graded ethanol solutions, cleared in chloroform, and embedded in Paraplast, and 5-µm sections were prepared. Alcian blue and Von Kossa staining was performed with 0.6% Alcian blue 8 GX (Sigma, St. Louis, MO) in 70% ethanol and 2% silver nitrate (Sigma) exposed to sunlight. TRAP staining was performed with a detection kit for acid phosphatase, in the presence of tartrate (Sigma). For hybridization, sections were deparaffinized in xylene, rehydrated through a graded series of ethanol solutions, rinsed in distilled water (5 min), and incubated in 2x SSC at 70°C for 30 min. The sections were then rinsed in distilled water and treated with pronase (0.125 mg/ml in 50 mM Tris·HCl, 5 mM EDTA, pH 7.5) for 10 min. After digestion, the slides were rinsed in distilled water, fixed in 10% formaldehyde in PBS, blocked in 0.2% glycine, rinsed in distilled water, rapidly dehydrated through a series of graded ethanol solutions, and air dried for several hours. The sections were then hybridized with digoxigenin-labeled antisense probes or with sense probes for controls (32). Immunohistochemistry was performed on parallel sections, with a 1:250 dilution of the OPN antisera containing 3% goat serum or with nonimmune serum as a control. As the second antibody, affinity-purified goat anti-rabbit IgG horseradish peroxidase (Jackson Immuno Research) was used at a 1:500 dilution. Methyl green was used as a counterstain.
Preparation of chicken probes.
Probes for Northern blot and in situ hybridization were prepared by PCR amplification of cDNA from both chicken growth plates and primary cultured chondrocytes, with the following primers. OPN: Forward TAGGAGTTGCTGCTGGGATT, Backward CCTGGTGGTACCTGTGTGTG; Col II: Forward GCTCCCAGAACGTCACCTAC, Backward ATATCCACGCCAAACTCCTG; Col X: Forward CCACCTGGATTCTCCACTGT, Backward TCCAAATCCTGGAAGACCTG; MMP2/Gel A: Forward TTCCAAGAAAGCCAAAATGG, Backward GCTGGTAGAAGCACACCACA; MMP9/Gel B: Forward ACCGTGCCGTGATAGATGAT, Backward AGCCACCAAGAAGATGCTGT; MMP13: Forward AGGAGATGCCCATTTTGATG, Backward CAGGATGCGGACAATTCTTT.
The PCR products were used for Northern blot analysis or ligated into pGEM constructs for in situ hybridization.
Statistical analysis.
The results are expressed as means ± SD. Differences between groups were tested by analysis of variance using Student's t-test; differences were considered significant at P < 0.05, and statistical tests were performed by JMP software (SAS Institute 2000).
 |
RESULTS
|
|---|
Effect of weight loading on bone elongation.
In the chicks carrying bags weighing 10% of their BW (Bag groups), a decrease in weight gain was observed after 2 days relative to the Ctrl 2d group, which became more pronounced after 4 days (Fig. 1A). However, no differences in feed efficiency were found between these groups, suggesting that the Bag groups had lower BWs as a result of reduced feed consumption rather than energy loss or other metabolic problems (Fig. 1A). This was further confirmed by the observation that the PF group had a low BW, like that of the Bag group, but did not differ in its bone measurements or growth plate histology from the controls. After 4 days, tibia length and diameter showed significant differences between Bag and Ctrl chicks: tibia length was 40.6 ± 1.15 mm in Ctrl 4d chicks vs. 34.4 ± 2.7 mm in the Bag 4d ones; diameters (measured in the middle of the bone) averaged 2.9 ± 0.2 mm and 2.1 ± 0.2 mm for these two groups, respectively. Femur length was also reduced in the Bag 4d chicks, from 29.7 ± 1.5 mm in the Ctrl 4d group to 25.8 ± 1.4 mm.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 1. A: body weight (BW) gain, feed consumption, and feed efficiency (means ± SD) of chicks that carried a mechanical load for 2 days (Bag 2d) or 4 days (Bag 4d), chicks that were not weight loaded at 2 and 4 days (Ctrl 2d/4d), and chicks that were pair fed (PF) with the Bag 2d and 4d chicks (PF 2d/4d). Values followed by different letters differed significantly at P < 0.05. B: tibia length and diameter of weight-loaded (Bag) chicks differed from those of nonloaded chicks [Ctrl, PF, and fitted with a saddle of similar construction as the harness, but weighing 1% of the chick's BW (Sad)] after 4 days. Values followed by different letters differed significantly at P < 0.05. C: growth plate sections were stained with hematoxylin and eosin. The growth plates of the weight-loaded chicks after 4 days (Bag 4d) were narrower than those of the controls (Ctrl 4d). Growth plates of chicks from the Sad and the PF groups had the same width as the controls. Growth plate is marked with an arrow. Magnification x7.5.
|
|
The detected differences in bone size were reflected in the width of the growth plates. Hematoxylin and eosin staining of growth plate sections revealed that those of the Bag chicks were narrower than those of their corresponding controls. After 2 days, the growth plate width in the Bag group was 95 ± 4% that of the Ctrl group, down to 74 ± 4% after 4 days. Longitudinal measurements showed a significant reduction in the heights of the articular cartilage (from 1.25 ± 0.25 mm in the controls to 0.93 ± 0.05 mm in the Bag 4d group), the proliferative zone (from 1.1 ± 0.16 mm to 0.81 ± 0.06 mm, respectively), and the hypertrophic zone (from 2.54 ± 0.56 mm to 1.62 ± 0.33 mm, respectively), as a result of the mechanical loading. Lateral measurements of the articular cartilages, proliferative zones, and hypertrophic zones of these groups did not differ significantly.
The Sad and PF groups, serving as controls for the bag-harnessing procedure and the reduced weight, respectively, had the same bone sizes (Fig. 1B) and similar growth plate widths as the Ctrl 4d groups (Fig. 1C). The lack of difference between the PF and Ctrl groups indicates that the changes in growth plate width resulted directly from the weight loading and not from reduced feed consumption.
Effect of weight loading on growth plate proliferation, differentiation, and ossification.
To determine whether the narrower growth plate was a consequence of alterations in chondrogenesis or osteogenesis, Alcian blue and Von Kossa staining was applied to growth plates from Bag 2d (Fig. 2A) and Bag 4d chicks (Fig. 2B). Von Kossa staining, which stains minerals black, was altered in the 4-day bag-carrying group. The staining was localized to the cartilage-bone interface, and penetrated into the cartilage, such that it reduced the noncalcified portion of the growth plate (Fig. 2). This phenomenon was not pronounced after 2 days of weight loading (Fig. 2A), but it increased with time, suggesting that the load caused an increase in growth plate ossification, thereby reducing its width.

View larger version (117K):
[in this window]
[in a new window]
|
Fig. 2. Time-dependent growth plate narrowing by mechanical load. Histological sections of chick bones, stained with Alcian blue and Von Kossa at x7.5 magnification. The arrow marks the growth plate width in chicks with (Bag) or without (Ctrl) mechanical load. Bags were loaded after 2 days of adaptation, and the growth plates were taken after 2 days (A) or 4 days (B) of the experiment.
|
|
Northern blot analysis and in situ hybridization were used to analyze the expression of genes relevant to growth plate chondrocyte proliferation, differentiation, and ossification from Ctrl 4d and Bag 4d chicks (Fig. 3). The expression levels of Col II (characteristic of proliferative chondrocytes) and Col X (typical of differentiated chondrocytes) were only slightly altered by the loading, by factors of 1.07 and 0.8 for Col II and Col X, respectively (Fig. 3, A and C). These genes were expressed in narrower expression zones as a result of mechanical loading (Fig. 3, B and D). Moreover, the transition zone between the cells expressing Col II and those expressing Col X was sharper in the growth plates of the Bag chicks than in those of the Ctrl groups (Fig. 3, B and D). These results suggest that weight loading facilitated a more homogeneous differentiation of the chondrocytes in the growth plate from the proliferative to hypertrophic state.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 3. Effects of mechanical load on chondrocyte gene expression. A and C: growth plates were dissected from the weight-loaded (Bag) or nonloaded (Ctrl) chicks. Total RNA was extracted, and 10-µg samples were subjected to Northern blot analysis with 32P-labeled probes of chicken collagens type II (Col II) and type X (Col X). The amounts of RNA were visualized by methylene blue staining of 18S ribosomal RNA. Gene expression was analyzed by scanning densitometry, relative to the expression of 18S ribosomal RNA and compared with Ctrl. B and D: localization of Col II and Col X gene expression. Sections were subjected to in situ hybridization with digoxigenin-labeled riboprobes of antisense chicken Col II and Col X. B: Col II mRNA can be detected in the proliferation zone (PZ) located between the articular cartilage (AC) and the hypertrophic zone (HZ). D: Col X mRNA can be detected in the HZ.
|
|
Effect of weight loading on OPN expression and osteoclast activity.
Expression of OPN mRNA increased more than fourfold as a result of weight loading (Fig. 4A), and this effect was most pronounced in the hypertrophic zone of the growth plates (Fig. 4B). The progression of the OPN expression front in the growth plate matched the advancing ossification front seen in the Von Kossa staining (Fig. 2A). The metaphyseal bone adjacent to the growth plate in the Bag chicks expressed OPN only in the osteoblasts, whereas the corresponding bone in the Ctrl chicks contained chondrocytes in a parallel area, suggesting that the ossification process in the Bag groups had been accelerated in this location as well (Fig. 4B, x100 bone zone).

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 4. Effects of mechanical load on osteopontin (OPN) gene expression. A: growth plates were dissected from weight-loaded (Bag) or nonloaded (Ctrl) chicks. Total RNA was extracted, and 10-µg samples were subjected to Northern blot analysis with 32P-labeled probes of chicken OPN. The amounts of RNA on the membrane were visualized by methylene blue staining of the 18S ribosomal RNA. Gene expression was analyzed by scanning densitometry, relative to the expression of 18S ribosomal RNA, and was compared with that of the Ctrl. B: localization of OPN gene expression. Growth plates from Bag and Ctrl chicks were subjected to in situ hybridization with digoxigenin-labeled riboprobes of antisense chicken OPN or of the sense probe (SENSE) as a control. OPN mRNA was detected at various magnifications (x7.5, x20), in the cartilage zone (x100 C), and in the bone zone (x100 B). Boxes indicate areas of higher magnification. C and D: OPN expression and tartarate-resistant acid phosphatase (TRAP)-positive cells in the growth plates of Bag and Ctrl chicks. After 2 days (C) and 4 days (D) of the experiment, sections were subjected to immunohistochemistry with avian OPN antibodies or with nonimmune serum (Ab) and mounted with methyl green. TRAP staining of an adjacent section was performed and is shown at x7.5 magnification. E: immunohistochemistry of OPN expression in the growth plate at x200 magnification. Arrows mark atypical localization of OPN-expressing chondrocytes.
|
|
Increased protein levels of OPN, observed immunohistochemically, were most pronounced in the hypertrophic zone and at the bone-cartilage interface of the growth plates of Bag chicks (Fig. 4, C and D), similar to the OPN mRNA expression (Fig. 4B). This was observed after 2 days (Fig. 4C) and was enhanced after 4 days (Fig. 4D). The TRAP activity front, which indicates the location of mature active osteoclasts, ran parallel to that of OPN protein expression: it appeared after 2 days (Fig. 4C) and intensified with time (Fig. 4D) in the Bag groups. The differences between the respective groups' ossified fronts, detected by Von Kossa staining (Fig. 2A), became visible later (on 4d), as expected, because ossification follows resorption of the matrix by the osteoclasts. Furthermore, OPN protein expression was also observed in single cells of the prehypertrophic zone in the Bag chicks, a location in which the control growth plates did not express OPN (Fig. 4E).
Effect of weight loading on growth plate vascularization.
Along the growth plates, there were significantly fewer chondrocytes in the Bag groups' bones, in both the proliferative (58.3 ± 4.5 cells in Ctrl bones, compared with 47 ± 2.9 cells in Bag bones) and hypertrophic (71.3 ± 5.1 compared with 56 ± 2.8 cells, respectively) zones (Fig. 5A). However, the ratios between the numbers of proliferative and hypertrophic chondrocytes in those areas did not differ between groups, consistent with the expression patterns of Col II and X.

View larger version (79K):
[in this window]
[in a new window]
|
Fig. 5. A: longitudinal counting of the growth plate cells and blood vessels that reach the growth plate on 4 different blocks. Increased load reduced the numbers of cells in the proliferative and hypertrophic zones and enhanced the penetration of blood vessels into the growth plates of the weight-loaded chicks. B: localization of MMP gene expression. Growth plates were dissected from weight-loaded (Bag) and nonloaded (Ctrl) chicks. Total RNA was extracted from these tissues, and 10-µg samples were subjected to Northern blot analysis with 32P-labeled probes of chicken MMP2/Gel A, MMP9/Gel B, and MMP13. The amounts of RNA on the membrane were visualized by methylene blue staining of the 18S ribosomal RNA. Gene expression was analyzed by scanning densitometry, relative to the expression of 18S ribosomal RNA, and compared with that of the Ctrl. C: localization of gelatinase (Gel) B (MMP9) gene expression. Growth plates from Bag and Ctrl chicks were fixed, and sections were subjected to in situ hybridization with labeled riboprobes of antisense chicken gelatinase B or of the sense probe as a control. Loading increased the mRNA of gelatinase B detected in the cells around growth plate blood vessels (x200).
|
|
The number of vascular vessels in the chondro-osseous junction, across the width of the hypertrophic zone, was found to be significantly higher in the growth plates of the Bag chicks, 22.2 ± 2.3 vs. 15.9 ± 2.8 in Ctrl groups (Fig. 5A). Therefore, the expression of two gelatinases, MMP2 and 9, and of the collagenase MMP13, all known to be expressed in the growth plate and to be related to growth plate vascularization (7), was evaluated (Fig. 5B). The expressions of MMP9 and 13 were increased by 1.47- and 1.59-fold, respectively, and that of MMP2 by 1.22-fold as a result of weight loading for 4 days (Fig. 5B). Upregulation of MMP9/Gel B was also demonstrated in situ (Fig. 5C). In a recent study (56), our laboratory showed the expression pattern of the chicken 75-kDa gelatinase B-like enzyme (MMP9) in the avian growth plate. Here we found that weight loading does not affect its typical localization; rather, it increases the number of MMP9-expressing chondrocytes surrounding the blood vessels (Fig. 5C). The gene-expression results are complementary to and even strengthen the findings regarding the effect of weight loading on growth plate vascularization. Together, they suggest that growth plate vascularization is enhanced in the Bag chicks and is accompanied by the induced expression of members of the MMP family.
 |
DISCUSSION
|
|---|
The effect of mechanical loading on the density of mature bone has been widely studied in animal models (57), as well as in human physiological and pathological conditions (10). However, the effect of mechanical loading on the process of young bone elongation is less clear (46). In the present study, we loaded young chicks with a bag that weighed 10% of their BW during their period of fastest growth and found decreases in the length and diameter of the long bones (tibia and femur). Both similar and conflicting findings on the effects of weight loading on bones have been obtained in studies with mice (43), rats (37), and chickens (8). However, in contrast to the present study, in which moderate physiological stresses were applied to the bones, many previous studies included either surgical procedures (26) or extreme nonphysiological conditions (59). Despite differences between avian and mammalian growth plates, the use of young chicks as a model has several advantages. First, they stand on two legs, unlike most mammalian species used as experimental models; this enables measuring the effect of physiological stresses on bone elongation without surgical intervention. Second, because broiler chickens have undergone breeding selection for accelerated growth, their rate of bone elongation at this age is very rapid, and the effects of small changes in their growth plates are maximized. Third, the avian growth plate is much wider than its mammalian counterpart (17), enabling quantitative measurements of gene expression. All in all, we believe that the information from this model reveals new aspects of the effect of weight loading on bone elongation.
We found that moderate loading (10% of BW) causes a significant narrowing of the growth plate, which is reflected in the reduced bone length. Weight loading the chick did not significantly alter the expression levels of Col II, a characteristic marker for proliferating chondrocytes, or Col X, which is typical of differentiated chondrocytes (40). Moreover, the reduction in growth plate width was not accompanied by changes in proportion between the different zones of the growth plate. On the other hand, significant alterations were observed in the mineralization and ossification processes in these growth plates. The progression of the mineralization front into the growth plate in the weight-loaded chicks indicated an enhanced ossification rate, which, in turn, reduced the growth plate width. In contrast to our findings, dynamic and static loading on rat ulnae were associated with a thicker hypertrophic zone in the growth plate (42), suppression of longitudinal mineralization rate, and a decrease in capillary invasion (37). Nevertheless, those phenomena also resulted in shorter bones. The tight linkage between vascularization and ossification is retained in all of the different models, albeit in opposite directions. This reflects the complexity of the longitudinal bone's growth process, which involves tight coordination and precise balance between cartilage formation and resorption within the growth plate: any disturbance in this balance may result in a short-bone phenotype.
One explanation for the accelerated ossification might be the elevated levels of OPN, which increased fourfold in the growth plates of the weight-loaded chicks. An in situ demonstration of OPN expression, which is usually restricted to the hypertrophic zone (21), showed a wider and more extensive region of expression in the growth plate of the weight-loaded chicks, suggesting increases in both the amount of RNA expressed by each cell and the number of cells expressing it. The pattern of OPN protein expression in extended regions of the growth plate overlapped the gene-expression pattern and the location of active osteoclasts, as identified by TRAP staining. Although OPN-null mice have a normal bone structure, more extensive studies have shown that OPN deficiency produces osteoclast dysfunction (48) and affords protection against ovariectomy-induced bone loss (18, 63). Ishijima et al. (18) showed that suspending mice by their tails produces severe osteoporosis in normal but not OPN-null mice, thus confirming the role of OPN as a mediator of osteoclast activity and bone sensitivity to loading. Furthermore, a positive correlation between mechanical strain induction and OPN gene expression has been observed in various systems, including teeth (54), chicken egg shell gland (24), and many cell types in vitro (14, 20, 22, 55). Nevertheless, the present study shows for the first time that mechanical loading upregulates OPN expression in growth plate chondrocytes in vivo, and this might be crucial for the precocious mineralization in the chondro-osseous region of the growth plate.
Mechanical strain elicits angiogenic features, as demonstrated in the chorioallantoic membrane (2). In the present study, it increased the number of blood vessels that invaded the growth plates of weight-loaded chicks and enhanced MMP expression. MMPs degrade the matrix and thus allow penetration of endothelial cells and the release of matrix-trapped growth factors that accelerate angiogenesis, such as VEGF and FGF, among others (11, 50, 61). Expressions of MMP9 and MMP13 were enhanced by 50% in the weight-loaded chicks, whereas MMP2 was more moderately upregulated. These results are in agreement with other findings in which mechanical strain upregulated various MMPs in cultured chondrocytes (19), vascular smooth muscle cells (1), and teeth (53). The basal expression level of MMP9 and MMP13 in chondrocytes is low, but it can be induced by various factors (25, 56), in contrast to MMP2, which is expressed at higher levels but is less responsive than MMP9 (56). Haseneen et al. (15) showed that high-volume mechanical ventilation in the lungs increases the activation of MMP2 and that this effect is accompanied by an increase in membrane type-1 MMP. Others showed that shear stress induces MMP9 expression in chondrocytes (19), and teeth movements induce MMP8 and MMP13 expression (53). Thus the expression levels of the MMPs that we observed in the weight-loaded growth plate might present an incomplete representation of their role in its vascularization.
The enhanced stress imposed by weight loading caused the development of a phenotype consisting of short bones with narrowed growth plates, in which advanced ossification and vascularization were observed. In light of this observation and the gene-expression studies in these growth plates, we suggest a model to explain the effect of loading during elongation of young bones. It is hypothesized that the chondrocytes, and presumably other bone cells as well, absorb the mechanical strain in the growth plate and that this results in upregulation of OPN, MMP9, and MMP13. Induction of the MMPs then enhances matrix degradation and the attraction and penetration of blood vessels, through which osteoblasts and osteoclasts reach the chondro-osseous junction. There, they promote ossification. Upregulation of OPN may contribute to this process by recruiting and activating osteoclasts at the cartilage-bone interface, through the binding of RGD sequences to
V
3 integrin. Although this hypothetical mechanism is probably incomplete, it is nevertheless clear that weight loading of young bones dramatically affects their length and their growth plate physiology and should be taken into consideration during the rapid elongation phase of bone development.
 |
GRANTS
|
|---|
This work was supported by Research Grant award no. IS-3403-03 from BARD, the United States-Israel Binational Agricultural Research and Development Fund, and by a Poultry Board of Israel grant.
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful to Raya Reich for excellent technical assistance and to Mark Ruzal for animal maintenance.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: E. Monsonego-Ornan, Institute of Animal Science, the Volcani Center, Bet Dagan, The Hebrew Univ. of Jerusalem, Rehovot, Israel (E-mail: ornanme{at}agri.huji.ac.il)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Asanuma K, Magid R, Johnson C, Nerem RM, and Galis ZS. Uniaxial strain upregulates matrix-degrading enzymes produced by human vascular smooth muscle cells. Am J Physiol Heart Circ Physiol 284: H1778H1784, 2003.[Abstract/Free Full Text]
- Baker AB and Sanders JE. Angiogenesis stimulated by mechanical loading. Microvasc Res 60: 177181, 2000.[CrossRef][Web of Science][Medline]
- Bianco P, Cancedda FD, Riminucci M, and Cancedda R. Bone formation via cartilage models: the "borderline" chondrocyte. Matrix Biol 17: 185192, 1998.[CrossRef][Web of Science][Medline]
- Bittner K, Vischer P, Bartholmes P, and Bruckner P. Role of the subchondral vascular system in endochondral ossification: endothelial cells specifically derepress late differentiation in resting chondrocytes in vitro. Exp Cell Res 238: 491497, 1998.[CrossRef][Web of Science][Medline]
- Bourrin S, Genty C, Palle S, Gharib C, and Alexandre C. Adverse effects of strenuous exercise: a densitometric and histomorphometric study in the rat. J Appl Physiol 76: 19992005, 1994.[Abstract/Free Full Text]
- Cancedda R, Descalzi Cancedda F, and Castagnola P. Chondrocyte differentiation. Int Rev Cytol 159: 265358, 1995.[Web of Science][Medline]
- Colnot CI and Helms JA. A molecular analysis of matrix remodeling and angiogenesis during long bone development. Mech Dev 100: 245250, 2001.[CrossRef][Web of Science][Medline]
- Cook ME, Patterson PH, and Sunde ML. Leg deformities: inability to increase severity by increasing body weight of chicks and poults. Poult Sci 63: 620627, 1984.[Web of Science][Medline]
- De Crombrugghe B, Lefebvre V, and Nakashima K. Regulatory mechanisms in the pathways of cartilage and bone formation. Curr Opin Cell Biol 13: 721727, 2001.[CrossRef][Web of Science][Medline]
- Duncan RL. Transduction of mechanical strain in bone. ASGSB Bull 8: 4962, 1995.[Medline]
- Engsig MT, Chen QJ, Vu TH, Pedersen AC, Therkidsen B, Lund LR, Henriksen K, Lenhard T, Foged NT, Werb Z, and Delaisse JM. Matrix metalloproteinase 9 and vascular endothelial growth factor are essential for osteoclast recruitment into developing long bones. J Cell Biol 151: 879889, 2000.[Abstract/Free Full Text]
- Franzen A, Oldberg A, and Solursh M. Possible recruitment of osteoblastic precursor cells from hypertrophic chondrocytes during initial osteogenesis in cartilaginous limbs of young rats. Matrix 9: 261265, 1989.[Web of Science][Medline]
- Gerber HP and Ferrara N. Angiogenesis and bone growth. Trends Cardiovasc Med 10: 223228, 2000.[CrossRef][Web of Science][Medline]
- Harter LV, Hruska KA, and Duncan RL. Human osteoblast-like cells respond to mechanical strain with increased bone matrix protein production independent of hormonal regulation. Endocrinology 136: 528535, 1995.[Abstract]
- Haseneen NA, Vaday GG, Zucker S, and Foda HD. Mechanical stretch induces MMP-2 release and activation in lung endothelium: role of EMMPRIN. Am J Physiol Lung Cell Mol Physiol 284: L541L547, 2003.[Abstract/Free Full Text]
- Huiskes R, Ruimerman R, van Lenthe GH, and Janssen JD. Effects of mechanical forces on maintenance and adaptation of form in trabecular bone. Nature 405: 704706, 2000.[CrossRef][Medline]
- Hunziker EB. Mechanism of longitudinal bone growth and its regulation by growth plate chondrocytes. Microsc Res Tech 28: 505519, 1994.[CrossRef][Web of Science][Medline]
- Ishijima M, Tsuji K, Rittling SR, Yamashita T, Kurosawa H, Denhardt DT, Nifuji A, and Noda M. Resistance to unloading-induced three-dimensional bone loss in osteopontin-deficient mice. J Bone Miner Res 17: 661667, 2002.[CrossRef][Web of Science][Medline]
- Jin G, Sah RL, Li YS, Lotz M, Shyy JY, and Chien S. Biomechanical regulation of matrix metalloproteinase-9 in cultured chondrocytes. J Orthop Res 18: 899908, 2000.[CrossRef][Web of Science][Medline]
- Klein-Nulend J, Roelofsen J, Semeins CM, Bronckers AL, and Burger EH. Mechanical stimulation of osteopontin mRNA expression and synthesis in bone cell cultures. J Cell Physiol 170: 174181, 1997.[CrossRef][Web of Science][Medline]
- Knopov V, Leach RM, Barak-Shalom T, Hurwitz S, and Pines M. Osteopontin gene expression and alkaline phosphatase activity in avian tibial dyschondroplasia. Bone 16: 329S334S, 1995.[Medline]
- Kubota T, Yamauchi M, Onozaki J, Sato S, Suzuki Y, and Sodek J. Influence of an intermittent compressive force on matrix protein expression by ROS 17/2.8 cells, with selective stimulation of osteopontin. Arch Oral Biol 38: 2330, 1993.[CrossRef][Web of Science][Medline]
- Kurata K, Uemura T, Nemoto A, Tateishi T, Murakami T, Higaki H, Miura H, and Iwamoto Y. Mechanical strain effect on bone-resorbing activity and messenger RNA expressions of marker enzymes in isolated osteoclast culture. J Bone Miner Res 16: 722730, 2001.[CrossRef][Web of Science][Medline]
- Lavelin I, Yarden N, Ben-Bassat S, Bar A, and Pines M. Regulation of osteopontin gene expression during egg shell formation in the laying hen by mechanical strain. Matrix Biol 17: 615623, 1998.[CrossRef][Web of Science][Medline]
- Leeman MF, Curran S, and Murray GI. The structure, regulation, and function of human matrix metalloproteinase-13. Crit Rev Biochem Mol Biol 37: 149166, 2002.[CrossRef][Web of Science][Medline]
- Lerner AL, Kuhn JL, and Hollister SJ. Are regional variations in bone growth related to mechanical stress and strain parameters? J Biomech 31: 327335, 1998.[CrossRef][Web of Science][Medline]
- Li KC, Zernicke RF, Barnard RJ, and Li AF. Differential response of rat limb bones to strenuous exercise. J Appl Physiol 70: 554560, 1991.[Abstract/Free Full Text]
- Mao JJ and Nah HD. Growth and development: hereditary and mechanical modulations. Am J Orthod Dentofacial Orthop 125: 676689, 2004.[CrossRef][Web of Science][Medline]
- Martignetti JA, Aqeel AA, Sewairi WA, Boumah CE, Kambouris M, Mayouf SA, Sheth KV, Eid WA, Dowling O, Harris J, Glucksman MJ, Bahabri S, Meyer BF, and Desnick RJ. Mutation of the matrix metalloproteinase 2 gene (MMP2) causes a multicentric osteolysis and arthritis syndrome. Nat Genet 28: 261265, 2001.[CrossRef][Web of Science][Medline]
- Meazzini MC, Toma CD, Schaffer JL, Gray ML, and Gerstenfeld LC. Osteoblast cytoskeletal modulation in response to mechanical strain in vitro. J Orthop Res 16: 170180, 1998.[CrossRef][Web of Science][Medline]
- Merry K, Dodds R, Littlewood A, and Gowen M. Expression of osteopontin mRNA by osteoclasts and osteoblasts in modelling adult human bone. J Cell Sci 104: 10131020, 1993.[Abstract]
- Monsonego E, Baumbach WR, Lavelin I, Gertler A, Hurwitz S, and Pines M. Generation of growth hormone binding protein by avian growth plate chondrocytes is dependent on cell differentiation. Mol Cell Endocrinol 135: 110, 1997.[CrossRef][Web of Science][Medline]
- Monsonego E, Halevy O, Gertler A, Hurwitz S, and Pines M. Growth hormone inhibits differentiation of avian epiphyseal growth-plate chondrocytes. Mol Cell Endocrinol 114: 3542, 1995.[CrossRef][Web of Science][Medline]
- Monsonego E, Halevy O, Gertler A, Volokita M, Schickler M, Hurwitz S, and Pines M. Growth hormone receptors in avian epiphyseal growth-plate chondrocytes. Gen Comp Endocrinol 92: 179188, 1993.[CrossRef][Web of Science][Medline]
- Morey ER and Baylink DJ. Inhibition of bone formation during space flight. Science 201: 11381141, 1978.[Abstract/Free Full Text]
- Mullender M, El Haj AJ, Yang Y, van Duin MA, Burger EH, and Klein-Nulend J. Mechanotransduction of bone cells in vitro: mechanobiology of bone tissue. Med Biol Eng Comput 42: 1421, 2004.[CrossRef][Web of Science][Medline]
- Ohashi N, Robling AG, Burr DB, and Turner CH. The effects of dynamic axial loading on the rat growth plate. J Bone Miner Res 17: 284292, 2002.[CrossRef][Web of Science][Medline]
- Oldberg A, Franzen A, and Heinegard D. Cloning and sequence analysis of rat bone sialoprotein (osteopontin) cDNA reveals an Arg-Gly-Asp cell-binding sequence. Proc Natl Acad Sci USA 83: 88198823, 1986.[Abstract/Free Full Text]
- O'Regan A and Berman JS. Osteopontin: a key cytokine in cell-mediated and granulomatous inflammation. Int J Exp Pathol 81: 373390, 2000.[CrossRef][Web of Science][Medline]
- Pines M, Knopov V, Genina O, Hurwitz S, Faerman A, Gerstenfeld LC, and Leach RM. Development of avian tibial dyschondroplasia: gene expression and protein synthesis. Calcif Tissue Int 63: 521527, 1998.[CrossRef][Web of Science][Medline]
- Rittling SR and Denhardt DT. Osteopontin function in pathology: lessons from osteopontin-deficient mice. Exp Nephrol 7: 103113, 1999.[CrossRef][Web of Science][Medline]
- Robling AG, Duijvelaar KM, Geevers JV, Ohashi N, and Turner CH. Modulation of appositional and longitudinal bone growth in the rat ulna by applied static and dynamic force. Bone 29: 105113, 2001.[Medline]
- Robling AG and Turner CH. Mechanotransduction in bone: genetic effects on mechanosensitivity in mice. Bone 31: 562569, 2002.[Medline]
- Roelofsen J, Klein-Nulend J, and Burger EH. Mechanical stimulation by intermittent hydrostatic compression promotes bone-specific gene expression in vitro. J Biomech 28: 14931503, 1995.[CrossRef][Web of Science][Medline]
- Senger DR, Perruzzi CA, and Papadopoulos A. Elevated expression of secreted phosphoprotein I (osteopontin, 2ar) as a consequence of neoplastic transformation. Anticancer Res 9: 12911299, 1989.[Web of Science][Medline]
- Sibonga JD, Zhang M, Evans GL, Westerlind KC, Cavolina JM, Morey-Holton E, and Turner RT. Effects of spaceflight and simulated weightlessness on longitudinal bone growth. Bone 27: 535540, 2000.[Medline]
- Sibonga JD, Zhang M, Ritman EL, and Turner RT. Restoration of bone mass in the severely osteopenic senescent rat. J Gerontol A Biol Sci Med Sci 55: B71B78; discussion B79B84, 2000.[Abstract]
- Sodek J, Ganss B, and McKee MD. Osteopontin. Crit Rev Oral Biol Med 11: 279303, 2000.[Abstract/Free Full Text]
- Steinberg ME and Trueta J. Effects of activity on bone growth and development in the rat. Clin Orthop 156: 5260, 1981.
- Sternlicht MD and Werb Z. How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol 17: 463516, 2001.[CrossRef][Web of Science][Medline]
- Stickens D, Behonick DJ, Ortega N, Heyer B, Hartenstein B, Yu Y, Fosang AJ, Schorpp-Kistner M, Angel P, and Werb Z. Altered endochondral bone development in matrix metalloproteinase 13-deficient mice. Development 131: 58835895, 2004.[Abstract/Free Full Text]
- Stokes IA, Mente PL, Iatridis JC, Farnum CE, and Aronsson DD. Enlargement of growth plate chondrocytes modulated by sustained mechanical loading. J Bone Joint Surg Am 84-A: 18421848, 2002.[Abstract/Free Full Text]
- Takahashi I, Nishimura M, Onodera K, Bae JW, Mitani H, Okazaki M, and Sasano Y. Expression of MMP-8 and MMP-13 genes in the periodontal ligament during tooth movement in rats. J Dent Res 82: 646651, 2003.[Abstract/Free Full Text]
- Terai K, Takano-Yamamoto T, Ohba Y, Hiura K, Sugimoto M, Sato M, Kawahata H, Inaguma N, Kitamura Y, and Nomura S. Role of osteopontin in bone remodeling caused by mechanical stress. J Bone Miner Res 14: 839849, 1999.[CrossRef][Web of Science][Medline]
- Toma CD, Ashkar S, Gray ML, Schaffer JL, and Gerstenfeld LC. Signal transduction of mechanical stimuli is dependent on microfilament integrity: identification of osteopontin as a mechanically induced gene in osteoblasts. J Bone Miner Res 12: 16261636, 1997.[CrossRef][Web of Science][Medline]
- Tong A, Reich A, Genin O, Pines M, and Monsonego-Ornan E. Expression of chicken 75-kDa gelatinase B-like enzyme in perivascular chondrocytes suggests its role in vascularization of the growth plate. J Bone Miner Res 18: 14431452, 2003.[CrossRef][Web of Science][Medline]
- Turner CH. Three rules for bone adaptation to mechanical stimuli. Bone 23: 399407, 1998.[Medline]
- Turner RT. Effects of short-term spaceflight and recombinant human growth hormone (rhGH) on bone growth in young rats. Aviat Space Environ Med 66: 763769, 1995.[Medline]
- Vico L, Barou O, Laroche N, Alexandre C, and Lafage-Proust MH. Effects of centrifuging at 2g on rat long bone metaphyses. Eur J Appl Physiol 80: 360366, 1999.[CrossRef][Web of Science]
- Vu TH. Don't mess with the matrix. Nat Genet 28: 202203, 2001.[CrossRef][Web of Science][Medline]
- Vu TH, Shipley JM, Bergers G, Berger JE, Helms JA, Hanahan D, Shapiro SD, Senior RM, and Werb Z. MMP-9/gelatinase B is a key regulator of growth plate angiogenesis and apoptosis of hypertrophic chondrocytes. Cell 93: 411422, 1998.[CrossRef][Web of Science][Medline]
- Williams B. Mechanical influences on vascular smooth muscle cell function. J Hypertens 16: 19211929, 1998.[CrossRef][Web of Science][Medline]
- Yoshitake H, Rittling SR, Denhardt DT, and Noda M. Osteopontin-deficient mice are resistant to ovariectomy-induced bone resorption. Proc Natl Acad Sci USA 96: 81568160, 1999.[Abstract/Free Full Text]
- Zou Y, Hu Y, Metzler B, and Xu Q. Signal transduction in arteriosclerosis: mechanical stress-activated MAP kinases in vascular smooth muscle cells (review). Int J Mol Med 1: 827834, 1998.[Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
M. Hasky-Negev, S. Simsa, A. Tong, O. Genina, and E. Monsonego Ornan
Expression of matrix metalloproteinases during vascularization and ossification of normal and impaired avian growth plate
J Anim Sci,
June 1, 2008;
86(6):
1306 - 1315.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Simsa, O. Genina, and E. M. Ornan
Matrix metalloproteinase expression and localization in turkey (Meleagris gallopavo) during the endochondral ossification process
J Anim Sci,
June 1, 2007;
85(6):
1393 - 1401.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Carre, X. Wang, T. E. Porter, Y. Nys, J. Tang, E. Bernberg, R. Morgan, J. Burnside, S. E. Aggrey, J. Simon, et al.
Chicken genomics resource: sequencing and annotation of 35,407 ESTs from single and multiple tissue cDNA libraries and CAP3 assembly of a chicken gene index
Physiol Genomics,
May 16, 2006;
25(3):
514 - 524.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2005 by the American Physiological Society.