Journal of Applied Physiology Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Appl Physiol 97: 475-483, 2004; doi:10.1152/japplphysiol.00763.2003
8750-7587/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giger, J. M.
Right arrow Articles by Baldwin, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giger, J. M.
Right arrow Articles by Baldwin, K. M.

Effect of cyclosporin A treatment on the in vivo regulation of type I MHC gene expression

Julia M. Giger, Fadia Haddad, Anqi X. Qin, and Kenneth M. Baldwin

Department of Physiology and Biophysics, University of California, Irvine, California 92697

Submitted 23 July 2003 ; accepted in final form 18 March 2004


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Rat soleus muscle consists predominantly of slow type I fibers. We have shown previously through deletion analysis that the highest level of reporter activity that we measure when injecting type I myosin heavy chain (MHC) promoter (MHC1)-linked luciferase plasmid into soleus muscles depends on the presence of a 550-bp upstream enhancer (3,450–2,900) region of the promoter. Because the calcineurin-nuclear factor of activated T cells (NFAT) pathway has been implicated in the regulation of the slow muscle gene program, particularly the MHC1 isoform, and the MHC1 promoter contains several putative NFAT sites, we examined via deletion and mutation analyses whether this pathway is involved in the regulation of promoter activity in soleus. Nine days of treatment with the calcineurin inhibitor cyclosporin A (CsA) caused a significant decrease in activity of the –3,500- and –3,450-bp promoters compared with vehicle-treated rats. Truncation of the promoter to –2,900 bp or smaller reduced the activity and also eliminated the CsA responsiveness, thus implying that the enhancer region is required for CsA responsiveness. Surprisingly, mutating the two NFAT elements within the enhancer region had no obvious effect on promoter activity. CsA treatment resulted in an increase in the mRNA levels of fast-type IIa and IIx MHC isoforms, but RT-PCR analysis of MHC1 pre-mRNA and mature mRNA expression in soleus muscles revealed no differences between vehicle- and CsA-treated rats. Although CsA affects the activity of the MHC1 promoter, it appears that its effect is not through direct binding of NFAT to sites on the promoter.

rat; soleus muscle; reverse transcription polymerase chain reaction; promoter; reporter; myosin heavy chain


THE CLASSIFICATION OF "SLOW" OR "FAST" muscle fibers is related to the type of myosin protein that is expressed (28). Myosin is a structural and functional protein in the muscle sarcomere, and myosin heavy chain (MHC) is an integral component of native myosin; it is directly involved in fiber shortening during muscle contraction. MHC in the adult rodent skeletal muscle exists as four isoforms: slow type I and fast types IIa, IIx, and IIb. The slow type I (or {beta}) MHC isoform (MHC1) is typically expressed in slow muscles, which are characterized by a relatively slow speed of contraction but exhibit fatigue resistance and thus are able to maintain contractile activity for long periods of time. They typically function as weight-bearing and postural muscles. In the rat soleus, a slow muscle in the hindlimb, ~90% of fibers express MHC1 (11, 15). The relationship between weight-bearing activity and the expression of MHC1 in soleus muscle is demonstrated by removing the factor of load in experimental animal models, achieved by subjecting the animal to either the microgravity environment of spaceflight (12) or through hindlimb suspension (5) such that the leg muscles bear little or no weight. When these manipulations are imposed, the expression of MHC1 in soleus is significantly reduced with a shift toward faster MHC isoforms (5, 12). At the other extreme, chronic functional overload (via the removal of muscle synergists) induces the expression of MHC1 in the plantaris, a fast muscle that normally does not significantly express the type I isoform (31).

Similar to the above-described variations in loading state, motor nerve input activity is also thought to play a key role in determining the muscle fiber phenotype. Mimicking the firing pattern characteristic of slow muscle nerves, chronic low-frequency stimulation of fast-twitch muscles induces a shift from fast to slower isoforms of MHC (26) and myosin light chain (2, 18) proteins. On the other hand, denervation, achieved by severing the sciatic nerve, eliminates the contractile activity of the soleus and results in a significant reduction in MHC1 expression and a concomitant increase in fast MHC isoforms (18). A greater degree of shift from slow to fast isoforms is also observed when soleus muscles are exposed to phasic high-frequency stimulation after denervation, which resembles the neural activity pattern of fast muscle nerves (15).

This plasticity of the MHC1 phenotype in response to environmental cues appears to be regulated by pretranslational (13, 31) and likely transcriptional processes (14, 17). However, the specific transcriptional mechanisms by which exogenous signals influence the expression of the MHC1 gene are unclear. A report in 1998 (6) implicated the calcineurin (CaN)-nuclear factor of activated T cells (NFAT) signaling pathway as the link between neural activity and the expression of slow isoforms in skeletal muscle. As described in several recent reviews (8, 16, 24, 27), CaN is an ubiquitous serine/threonine protein phosphatase and its activity is regulated by intracellular Ca2+ concentration. Activated CaN regulates NFAT function by the dephosphorylation of its regulatory domain, which triggers nuclear translocation and increases DNA-binding activity. Once translocated to the nucleus, the dephosphorylated NFAT activates transcription of specific genes. Rephosphorylation by certain nuclear kinases results in the export of NFAT from the nucleus. CaN activation can be inhibited by the binding of immunosuppressive drugs: cyclosporin A (CsA) or FK506.

The noteworthy report by Chin et al. (6) showed that, when the gene-promoter constructs of the slow-twitch muscle-specific slow troponin I isoform, as well as the oxidative myofiber-specific protein myoglobin, were transfected into Sol8 and C2C12 myocytes along with a constitutively active CaN expression vector, reporter activity increased significantly. Treatment with CsA as well as mutation of the NFAT sites in these promoters caused inhibition of the reporter activity. The authors concluded that the tonic neural activity pattern typical of slow muscle nerves sustains a level of intracellular Ca2+ that maintains CaN activity, which ultimately results in translocation of NFAT to the nucleus and subsequent binding to sites on the slow troponin I and myoglobin genes. Findings by Bigard et al. (3) further support the role of CaN in the expression of slow genes in vivo by showing a decrease in the expression of two slow isoforms of muscle-specific proteins, MHC1 and sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) 2a, and an increase in fast isoforms, MHC2a and SERCA1, in soleus muscle of rats treated with CsA for 3 wk.

An interesting rat study by Serrano et al. (30) showed that the expression of the MHC1 protein in regenerating and normal soleus muscle was blocked by CaN inhibitors CsA, FK506b, and CaN-inhibiting peptide [CAIN; a novel protein that interacts with the catalytic domain of CaN, inhibiting its activity (20)]. Also, the reporter activity of a –1,145-bp MHC1 promoter showed a robust decrease in response to CsA in normal soleus muscle. Moreover, in normal adult soleus muscles, transfection of a CAIN expression vector was associated with the expression of fast MHC2x and MHC2b transcripts, but not slow MHC1 or MHC2a transcripts, as detected by in situ hybridization. This report concluded that CAIN not only prevented a fast-to-slow MHC transformation in regenerating fibers but induced a switch from slow to fast MHC in normal soleus muscle. Therefore, Serrano et al. contend that the CaN pathway is involved in the maintenance as well as the induction of slow MHC expression in slow-type fibers.

We are interested in determining the regulatory factors that control MHC1 expression. In previous studies (9, 10), we injected a rat MHC1 promoter-reporter construct into soleus muscles. The reporter gene expression mimics the functional and fiber type-specific pattern as the endogenous type I gene. We determined through deletion analysis that the highest level of promoter activity that we measure depends on the presence of a 550-bp upstream "enhancer." The presence or absence of the enhancer did not affect promoter activity in fast-type plantaris muscle (10), suggesting that the enhancer region is only relevant in slow muscle. In light of the recent findings implicating the CaN-NFAT pathway in the regulation of the slow muscle fiber gene program, particularly the effect of CsA on the MHC1 promoter (30), the present report aims to test the hypothesis that this pathway is responsible for the relatively high level of reporter activity observed in normal soleus muscle when the enhancer region of the MHC1 promoter is present. The question as to whether those reported CaN effects on slow muscle gene expression (3, 6, 30) are in fact due to the direct binding of NFAT factors to the promoter can be examined with promoter analysis. Phase 1 of this study examined the sequence of the MHC1 promoter to identify any potential NFAT response elements (NREs) within the promoter. Then, in combination with treatment of the CaN inhibitor CsA, deletion analysis was performed to determine whether the enhancer region of the promoter contained essential NREs responsible for the promoter activity or CsA sensitivity. Phase 2 of the study entailed the mutation of specific NREs in the relevant CsA-sensitive region of the promoter. Phase 3 examined how the transcriptional or pretranslational activity of the endogenous MHC I gene responded to CsA treatment.

Our findings suggest that CsA treatment caused a significant decrease (>30%) in the reporter activity of only the –3,500 and –3,450 MHC1-firefly luciferase (Fluc) promoters in soleus muscle. However, –2,900 and smaller deletion promoters were not affected. Mutating the NREs in the upstream region of the promoter had no substantial effect on promoter activity. Subsequent examination of the endogenous MHC1 pre-mRNA expression showed no difference between vehicle- and CsA-treated rats, suggesting that transcriptional activity of endogenous type I gene may occur independently of NFAT. Thus, although it is possible that CsA affects the activity of MHC1 promoter, its effect may not act directly through NFAT binding sites on the MHC1 promoter.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reporter Plasmid Constructs

Plasmid construction was as described previously (9). The –3,500 and all shorter promoter fragments and specific mutations were subcloned by standard procedures into the reporter plasmid, a Fluc expression vector (pGL3 basic, Promega). All MHC1 sequences terminated at +34 from the transcription start site. A 2-kb promoter sequence of the human skeletal {alpha}-actin (gift from S. Swoap, Williams College) linked to a renilla luciferase reporter was used as the reference vector (9). Mutation constructs 3,500dNFATmut and 3,500pNFATmut consisted of a five-base substitution in the –3,500 MHC1 promoter designed to disrupt binding of NFAT to the targeted site in the promoter. Custom primers (Invitrogen, Carlsbad, CA) were used for mutagenesis (QuikChange Site-Directed Mutagenesis Kit, Stratagene) using the –3,500 wild-type sequence as a template. TESS database (http://www.cbil.upenn.edu/tess) was originally used to identify transcription-factor binding sites. This type of in silico analysis screens the test sequence and highlights possible matches of the sequence and gives the percent fidelity to known consensus sequences. Highlighted matches of interest are then compared with published consensus sequences. See Table 1 for sequences for NFAT mutation.


View this table:
[in this window]
[in a new window]
 
Table 1. Primer sequences for distal and proximal NFAT sites in rat type I MHC promoter

 
Animal Procedures

CsA injection.   Female Sprague-Dawley rats weighing 100–115 g were administered 20 mg/kg CsA (Sandimmune, Novartis). Control rats were administered the CsA vehicle, consisting of 67% cremophor EL (Sigma Chemical) and 33% ethanol. Both CsA and vehicle solutions were diluted in 0.9% saline and injected intraperitoneally in rats once daily for 9 days. At the end of the experimental period, blood samples were taken, and CsA levels were assessed by the Pathology Department of the University of California Irvine Medical Center. All samples that were analyzed showed blood CsA levels exceeding 1,000 ng/ml (vehicle-treated rats, <25 ng/ml). After the 9 days, soleus muscle tissues used for nuclear extraction were excised after pentobarbital sodium (100 mg/kg) euthanasia, quick frozen, and stored at –80°C for RNA analysis.

DNA injection.   On the third day of the treatment period, rats were anesthetized (10 mg ketamine-20 mg acepromazine per 100 g) for aseptic surgical-injection procedures. A skin incision was made to expose the soleus muscle. Twenty microliters of PBS containing a mixture of two supercoiled DNA plasmids [{beta}-MHC test plasmid (molar equivalent to 10 µg of –3,500-bp MHC-Fluc) and a control skeletal {alpha}-actin linked to a renilla luciferase reporter plasmid (molar equivalent to 5 µg of –3,500-bp MHC-Fluc)] were injected into the muscle with a 29-gauge needle attached to a 0.5-ml insulin syringe. Seven days after plasmid injection (9th day of treatment), soleus muscle tissues were excised after pentobarbital sodium (100 mg/kg) euthanasia, quick frozen, and stored at –80°C. All animals in the study were allowed food and water ad libitum, and all procedures were approved by the institutional animal care and use committee.

Reporter Expression Assay

Frozen muscle tissues were homogenized in ice-cold passive lysis buffer from Promega by use of a glass homogenizer. The homogenate was centrifuged at 10,000 g for 10 min at 4°C. The supernatant was reserved for the luciferase activity assay using Promega's Dual Luciferase Assay kit, which is designed for sensitive detection of both Fluc and renilla luciferase activities in a single-extract aliquot. Activities were measured as total light output (as measured by a Monolight 2010-C luminometer) per muscle per second and were expressed as relative light units. Background levels, based on luciferase activities of noninjected tissue, were subtracted from the activities of test samples. These experiments were predicated on the assumption that the level of luciferase activity is proportional to the degree of promoter activity.

Nuclear Extraction of Skeletal Muscle Tissue

Nuclear protein was extracted from skeletal muscle according to the method described by Blough et al. (4). Briefly, frozen soleus muscle tissue (~200–300 mg) was homogenized in 35 ml of buffer 1 (10 mM HEPES, pH 7.5; 10 mM MgCl2; 5 mM KCl; 0.1 mM EDTA, pH 8.0; 0.1% Triton X-100; 0.2 mM PMSF, 2.5 µg/ml aprotinin, 2.5 µg/ml leupeptin, 1 mM DTT). Homogenates were centrifuged for 5 min at 3,000 g at 4°C. The pellets were resuspended in 500–1,000 µl of buffer 2 (20 mM HEPES, pH 7.5; 500 mM NaCl; 1.5 mM MgCl2; 0.2 mM EDTA, pH 8.0; 25% glycerol; 0.2 mM PMSF, 2.5 µg/ml aprotinin, 2.5 µg/ml leupeptin, 0.5 mM DTT). Suspension was incubated on ice with intermittent mixing for 30 min and centrifuged for 5 min at 4,000 g at 4°C. The supernatant was transferred to an Amicon 2-ml Centricon filter unit (YM-10; Millipore, Bedford, MA). An equal volume of binding buffer (20 mM HEPES, pH 7.9; 40 mM KCl; 2 mM MgCl2; 10% glycerol; 0.2 mM PMSF, 2.5 µg/ml aprotinin, 2.5 µg/ml leupeptin, 0.5 mM DTT) was added to the filter unit and centrifuged for 30 min at 4,500 g at 4°C. Another 500–1,000 µl were added and centrifuged again for 3 min, and centrifugation was repeated until concentrate achieved the desired volume (1 ml). Protein concentration of nuclear extract was determined by using the Bio-Rad protein assay with BSA as a standard. Nuclear extract samples were stored at –80°C.

Gel Mobility Shift Assay

Gel mobility shift assays (GMSAs) were used to examine binding of nuclear extract protein to the dNFAT and pNFAT cis-regulatory element of the rat MHC1 gene promoter. All oligonucleotide sequences were purchased from Invitrogen Life Technologies (Carlsbad, CA). The sequences of the sense strand are dNFAT 5': AATCCTTGGAAAAACCCACCTTGAC 3'; dNFATmut5': AATCCTTAACGCAACCCACCTTGAC 3'; pNFAT 5': CTGTGGAAAGCAGAGATTGGGAGAA 3'; pNFAT mut5': CTGTAACGCGCAGAGATTGGGAGAA; and unrelated: 5' GTTAAGTGACTGAGCTAGACCACAC 3'. Underlined are bases that were mutated. The mutant sequences of dNFAT and pNFAT contain the same 5-bp mutation as that used in the promoter studies (Table 1). After strand annealing, the double-stranded probe was end labeled with [{gamma}-32P]ATP (6,000 Ci/mmol) using T4 polynucleotide kinase (New England Biolabs, Beverly, MA). For each binding reaction, 20 µg of a control soleus nuclear extract were preincubated for 10 min at room temperature with 225 ng of poly(dI-dC) homopolymer, which was used as a nonspecific competitor, in a binding buffer containing 40 mM KCl, 1 mM DTT, 1 mM EDTA, 1 mM MgCl2, 7.5% glycerol, 0.05% BSA, and 20 mM HEPES, pH 7.9, in a total volume of 20 µl. For competition studies, the preincubation was carried out in the presence of 150x molar excess of either cold dNFAT or pNFAT weight (self), a cold mutated dNFAT or pNFAT, or unrelated MHC1 promoter oligonucleotide (nonspecific). At the end of the preincubation, 100,000 cpm of labeled dNFATwt, dNFATmut, pNFATwt, or pNFATmut were added and incubated for 30 min at room temperature. In some cases, 2 µl of NFATc1 monoclonal antibody (Affinity Bioreagents, Golden, CO) were added 15 min after incubation with the probe, and incubation was continued for 15 min more. At the end of the reaction, 2 µl of loading buffer (20% Ficoll, 0.2% bromophenol blue, and 0.2% xylene cyanol) were added, and the reaction mixtures were loaded on a 6% polyacrylamide gel, which was preelectrophoresed at 20 mA/gel for 2 h. Electrophoresis was carried out in 0.5x Tris-borate/EDTA buffer at constant current (30 mA) at room temperature for 3 h. After electrophoresis, the gels were dried, and the bands were visualized by phosphorimaging (Molecular Dynamics, Sunnyvale, CA).

MHC RNA Analyses

Total RNA isolation.   Total RNA was extracted from preweighed frozen muscle samples with the use of TRI Reagent (Molecular Research Center, Cincinnati, OH) according to the protocol supplied by the manufacturer, which is based on the method described by Chomczynski and Sacchi (7). Extracted RNA was precipitated from the aqueous phase with isopropanol, and after a wash with ethanol, it was dried and suspended in a small volume of nuclease-free water. All RNA samples used for these analyses were treated with DNase (Promega) to remove any trace of genomic DNA contamination. After DNase treatment, the RNA samples were reextracted with Tri Reagent liquid sample kit (Molecular Research Center), and the RNA pellet was suspended in nuclease-free water. The RNA concentration was determined by ultraviolet absorption at 260 nm, and the samples were stored at –80°C for subsequent analysis with RT-PCR.

RT.   One microgram of total RNA was reverse transcribed for each muscle sample with the use of the SuperScript II RT from Invitrogen and a mix of oligo(dT) (100 ng/reaction) and random primers (200 ng/reaction) in a 20-µl total reaction volume at 45°C for 50 min, according to the provided protocol. At the end of the RT reaction, the tubes were heated at 90°C for 5 min to stop the reaction and then were stored at –80°C until they were used in the PCR reactions for specific MHC mRNA analyses (see below).

PCR.   A relative RT-PCR method using 18S as an internal standard (Ambion, Austin, TX) was applied to study the expression of specific MHC mRNAs. Sequences for the various primers used for the specific target mRNAs is shown in Table 2. In each PCR reaction, 18S ribosomal RNA was coamplified with the target cDNA (mRNA) to serve as an internal standard and to allow correction for differences in starting amounts of total RNA. For the 18S amplification, we used the Alternate 18S internal standard (Ambion), which yields a 324-bp product. The 18S primers were mixed with competimers at an optimized ratio of 3 to 1. Inclusion of 18S competimers was necessary to attenuate the 18S signal, which allows its linear amplification to the same range as the coamplified target mRNA (Ambion, relative RT-PCR kit protocol).


View this table:
[in this window]
[in a new window]
 
Table 2. Type I MHC specific RT-PCR primers sequence from the 5' to the 3' direction

 
For each specific target MHC mRNA compared in this study, the RT and PCR reactions for all the samples were carried out under identical conditions with the same reagents premix. One microliter of each RT reaction (20- to 30-fold dilution depending on target mRNA abundance) was used for PCR amplification. PCR reactions were carried out in the presence of 1.5 mM MgCl2 using standard PCR buffer (GIBCO), 0.2 mM dNTP, 1 µM specific primer set, 0.5 µM 18S primer/competimer mix, and 0.75 U of DNA Taq polymerase (Bioline) in 25-µl total volume. Amplifications were carried out in a Stratagene Robocycler with an initial denaturing step of 3 min at 96°C, followed by 23–25 cycles of 1 min at 96°C, 45 s at 56–58°C, 45 s at 72°C, and a final step of 3 min at 72°C. PCR products were separated on a 2% agarose gel by electrophoresis and stained with ethidium bromide, and signal quantification was conducted by laser-scanning densitometry, as reported previously (34). In this approach, each MHC mRNA signal is normalized to its corresponding 18S. For each primer set, PCR conditions (cDNA dilution, the annealing temperature, and the number of cycles) were optimized so that both the target mRNA and 18S product yields were in the linear range of the semi-log plot when the yield is expressed as a function of the number of cycles.

Analyses of type I MHC pre-mRNA.   For specifically targeting the type I mRNA and pre-mRNA, we used a selective RT-PCR approach by which only the targeted RNA species are reverse transcribed and amplified. Thus, for each sample, 1 µg of total RNA was reverse transcribed by Superscript II (Invitrogen) and MHC1 mRNA-specific antisense primer (RT primer in Table 1). This specific RT reaction was followed by specific amplification of both the mRNA and pre-mRNA. The PCR for amplification of MHC1 mRNA used primers 1 and 2 and 1 µl of cDNA template diluted 40-fold and was carried out for 24 cycles, which resulted in a 546-bp PCR product. PCR to amplify MHC1 pre-mRNA was similar to the above except that the cDNA dilutions were only fivefold. The primers used were primers 3 and 4, and the number of cycles was raised to 30. This resulted in a 186-bp product. Primer 3 is derived from the last intron of the MHC1 gene. Thus this primer can target only pre-mRNA. The number of cycles and the PCR conditions for each target mRNA were optimized so that the amplified signal was still on the linear portion of a semi-log plot of the yield expressed as a function of the number of cycles. As a check for genomic DNA contamination, PCR reactions were carried out with an equal amount of non-RT RNA. These reactions turned out negative, thus validating the effectiveness of DNase treatment. PCR products were separated on a 2% agarose gel by electrophoresis, and they were stained with ethidium bromide. The signal quantification was conducted by laser-scanning densitometry as reported previously (34).

Note that in this procedure it is not possible to normalize the signal to a reference RNA standard because the RT reaction was selective to MHC1 RNA/pre-mRNA. Accuracy and precision are important for such a determination. To keep the processing variability to a minimum, all samples (control and experimental) were processed at the same time, under identical conditions, and used the same premixed reagents to ensure homogeneity. Also, all samples were run in duplicates.

Statistical Analysis

Statistical analysis was performed with the Graphpad Prism 4.0 statistical software package. Values are means ± SE. Differences between the means of two experimental groups were assessed by an unpaired, two-tailed t-test. P < 0.05 was taken as the level of statistical significance.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Deletion Analysis of MHC I Promoter Identifies CsA-Responsive Region

Examination of putative regulatory sites in the –3,500 MHC1 promoter using the TESS database revealed nine potential NFAT sites within the promoter (Fig. 1), with three of these sites located in the enhancer region (9). It is possible that the CaN-NFAT cascade is responsible for maintaining the MHC I promoter activity that we observe routinely in soleus muscle (9, 10). To test the hypothesis that CaN-activated NFAT regulates reporter gene expression by interacting directly with NFAT sites on the promoter, we examined reporter activity after treatment with the CaN inhibitor CsA. Compared with vehicle-treated rats, the activity of the –3,500 promoter was significantly reduced after 9 days of CsA treatment (Fig. 1). Because the locations of the nine putative sites are interspersed throughout the length of the promoter, deletion analysis was performed to determine which segment(s) of the promoter contains the relevant NFAT site(s). Deleting 50 bp from –3,500 eliminated the most distal putative NFAT (at –3,470); yet the reporter activity of this –3,450 promoter was similar to that of the –3,500 promoter and still responded to CsA.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 1. Deletion analysis of type I myosin heavy chain (MHC) promoter in soleus muscles of vehicle (Veh)- and cyclosporin A (CsA)-treated rats. Left: MHC1 promoter putative regulatory cis elements and nuclear factor of activated T cells (NFAT) responsive elements. There are 9 putative NFAT response elements in the –3,500-bp MHC1 promoter. Right: bar graph shows promoter activity in soleus muscles of rats treated (daily intraperitoneal injection) with 20 mg/kg CsA or Veh for 9 days. Derived from the parent promoter, –3,500-bp deletion constructs, –3,450, –2,900, –914, and –408 (top to bottom, respectively) of the I-MHC promoter were injected into soleus muscles. Promoter activity values represent relative firefly luciferase (Fluc) activity determined by the ratio of MHC1 promoter-driven Fluc light units to skeletal {alpha}-actin-driven renilla luciferase light units [MHC1-Fluc/skeletal {alpha}-actin linked to a renilla luciferase reporter (sk.{alpha}-actin-Rluc)]. Values are means ± SE; n ≥ 8 soleus muscles per each construct per group tested.*P < 0.05, CsA vs. Veh (t-test).

 
Three deletions (–2,900, –914, and –408), which resulted in the elimination of three, four, and eight of the nine putative NFAT sites, respectively, caused a significant reduction in reporter activity in vehicle-treated rats compared with the –3,500 promoter. There was no statistical difference in activity between these three deletions. This deletion analysis in vehicle-treated rats supports the notion of a so-called enhancer in the upstream region of the promoter, which is required for the highest level of activity observed with the –3,500 promoter, as described previously (9, 33). The fact that these smaller deletions were not sensitive to CsA treatment indicates that the CsA-responsive region is situated within the enhancer segment, i.e., between –3,450 and –2,900 bp of the promoter, and this segment contains two putative NFAT sites.

Mutation of NREs Does Not Affect Promoter Activity

To determine whether the two remaining NFAT sites at –3,389 and –3,049 are responsible for conferring the enhanced reporter activity and CsA sensitivity of the –3,500 promoter, these sites were mutated individually in the –3,500 promoter (Fig. 2). We hypothesized that, if one or both of these putative NFAT sites were required for the CsA response, their mutation would cause the promoter activity of both the vehicle-treated and the CsA-treated groups to be reduced to a similar level as the CsA-treated wild-type 3,500 promoter. However, the reporter activity of the 3,500 pNFATmut (at –3,049, the more proximal NFAT site of the two) mutant construct in vehicle- and CsA-treated rats was similar to that of the wild-type –3,500 promoter. Likewise, although there is a significant upregulation in reporter activity of the 3,500 dNFATmut (more distal NFAT –3,389) construct in vehicle-treated rats compared with that of the wild-type 3,500 promoter, this mutant is still responsive to CsA. A double mutant was created, which contained mutations of both proximal and distal NFAT sites to test whether there is a cooperative effect requiring both of the NFAT sites to be intact. Promoter activity of the double mutant was similar to that of the dNFAT construct alone. Therefore, the mutation analyses indicate that neither the dNFAT nor the pNFAT elements are responsible for maintaining MHC1 promoter activity in soleus or its sensitivity to CsA. Subsequently, an additional deletion, –3,100, was tested and found to act similarly to the –3,500 promoter in vehicle-treated rats but did not show a significant reduction due to CsA treatment. Comparing deletion sequences, it appears that the minimum promoter length for highest measured activity is –3,100, indicating that the enhancer is located between –2,900 and –3,100 but also that the CsA responsiveness is upstream, between –3,100 and –3,450.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. NFAT mutation has no effect on reporter activity. Graph depicts comparison of reporter activity of (from top to bottom) a wild-type –3,500 MHC1 promoter, 3,500 dNFATmut, 3,500 pNFATmut double mutant –3,500 dNFAT/pNFATmut, and wild-type –3,100 type I deletion promoter in soleus muscles of Veh- and CsA-treated rats, where d indicates distal, p indicates proximal, and mut indicates mutant. Activity values represent relative Fluc activity determined by the ratio of MHC1-Fluc to sk.{alpha}-actin-Rluc. Values are means ± SE; n ≥ 8 soleus muscle per each construct per group tested.*P < 0.05, CsA vs. Veh (t-test).

 
GMSAs

GMSAs were performed to verify that the dNFAT and pNFAT promoter sites that were mutated in the above-described promoter assays were indeed specific NFAT binding sites and to verify that the mutations were effective in disrupting NFAT binding. Double-stranded oligonucleotides corresponding to the dNFAT (Fig. 3A) or pNFAT (Fig. 3B) sequences were radiolabeled and examined in GMSAs with nuclear protein extracts from control soleus muscles as specified in METHODS. Several dark and light bands are resolved in both gels (Fig. 3), likely because of the less stringent conditions of the nuclear extraction method (4). However, there are specific binding complexes designated. Specificity was determined if bands were disrupted by competition with unlabeled self (lane 3) and were not detected when incubated with the radiolabeled mutant NFAT probe (lane 2) but were not competed by nonself oligonucleotides: NFATmut (lane 4) or unrelated sequence (lane 5). Addition of NFATc1 antibody (lane 6) disrupts the banding pattern, confirming that the sequence contains an NFAT recognition site. Therefore, these assays suggest that control soleus extracts likely contain an NFAT protein, which binds these dNFAT and pNFAT sequences in vitro. However, the promoter mutation analyses in vivo indicate that these NFAT sites are not relevant in conferring transcriptional activity of the MHC1 promoter.



View larger version (69K):
[in this window]
[in a new window]
 
Fig. 3. Representative gel mobility shift assays assessing the interaction of radiolabeled oligonucleotide probes with 20 µg of nuclear protein from control soleus muscles sample. With the use of rat MHC1 distal NFAT (dNFAT) and proximal NFAT (pNFAT) radiolabeled oligonucleotides as probes, several specific (Sp.) and nonspecific (ns) binding complexes were resolved. A: dNFAT binding was examined. Binding specificity was analyzed through competition assays by preincubating extracts with 150-fold molar excess of unlabeled oligonucleotides: self dNFAT (lane 3), nonself dNFATmut (lane 4), and unrelated sequence (lane 5). Only complexes Sp. denote specific high-affinity complexes because they are disrupted by competition with self but are not competed by nonself oligonucleotides. That the extracts are specifically binding an NFAT site is confirmed because the specific bands of Sp. were not detected when incubated with the radiolabeled mutant (Mut) dNFAT probe (lane 2). Also, the addition of a NFATc1 antibody (lane 6) disrupts the specific band pattern and causes a supershift (ss). B: proximal NFAT binding was examined (lane 2 is mutant pNFAT).

 
Endogenous Expression of pre-mRNA and Mature mRNA in Vehicle- and CsA-Treated Rats

Based on the notion that, by inhibiting CaN-NFAT cascade, CsA can inhibit the slow muscle gene program as determined by mRNA levels (3, 6), endogenous mRNA samples were also examined. Total RNA was isolated from soleus muscles of vehicle- and 9-day CsA-treated rats. RT-PCR analysis showed that CsA treatment was effective in inducing a change in the MHC mRNA profile of soleus muscles (Fig. 4). An increase in the relative level of MHC2a as well as an induction of MHC2x mRNA expression were detected in the soleus of CsA-treated rats. Against expectations, RT-PCR analyses of MHC1 mRNA indicated that CsA had no obvious impact on MHC1 expression relative to 18S (Fig. 4). We also adapted RT-PCR analysis by using a newly derived primer sequenced from the last intron of the MHC1 gene to examine levels of pre-mRNA as a gauge of transcriptional activity of the endogenous gene. Surprisingly, there was no change in the MHC1 pre-mRNA in response to CsA treatment (Fig. 5).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 4. Endogenous expression of MHC mRNA isoforms in soleus muscles of Veh- and CsA-treated rats. A: representative ethidium bromide-stained gel depicting the separation of the MHC mRNA product and 18S using relative RT-PCR methods. B: bar graph summarizes the data on adult MHC mRNA expression vs. 18S. MHC IIb mRNA was not detected in any of the samples. Data are means ± SE; n = 6/group. *P < 0.05, CsA vs Veh (2-tailed unpaired t-test).

 


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 5. Endogenous expression of MHC1 in soleus muscles of Veh- and CsA-treated rats. A: representative gels of PCR products of MHC1 pre-mRNA (1 µl of cDNA; 1:5 dilution; 30 cycles) and mRNA (1 µl of cDNA; 1:40 dilution; 25 cycles). Shown are results from 2 separate samples for each group. B: bar graph representation of densitometric scans of the gels shows no difference between 2 groups (n = 6) (Graph pad, Prism).

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The aim of this study was to determine whether the relationship between the slow muscle gene program and the CaN-NFAT pathway that has been reported in the literature could be confirmed in vivo. Specifically, we tested the hypothesis that the CaN-NFAT signaling pathway is responsible for maintaining the transcriptional activity of MHC1 isoform in slow fibers through regulatory elements in its promoter sequence. Reporter activity of the –3,500 MHC1 promoter in soleus was reduced after treatment of the CaN inhibitor CsA, whereas the activities of shorter deletion fragments were not. The two NFAT elements within this responsive region of the promoter were mutated to test the hypothesis that the higher level of activity, which depends on the enhancer (–3,450 to –2,900), in normal soleus was due to direct binding of NFAT to the promoter NFAT elements. GMSAs (Fig. 3) confirm that these two putative NFAT sites in this region interact specifically with an NFAT factor present in control soleus extracts. However, an expected decrease in reporter activity due to the mutated promoters was not observed, suggesting that the presence of these NFAT sites does not impact transcriptional activity of the slow MHC gene. A similar intriguing finding has been reported regarding the lack of effect of NFAT mutation on the MHC1 promoter in cardiomyocytes (21). Phenylephrine treatment caused a large upregulation of MHC1 expression and the activity of –348 and –215 MHC1 promoters; it also induced NFAT activation (21, 22), and NFAT has been shown to bind a proximal NFAT site (–173) in the promoter. However, mutating this NFAT site in either –348 or –215 promoters had no effect on reporter activity in primary cardiomyocytes with or without {alpha}1-adrenergic stimulation. At least nine NFAT sites can be identified in the –3,500/+34 MHC1 promoter via in silico sequence analysis; three of these sites are confirmed NFAT elements (Ref. 21 and this report). However, it seems that the presence of these NFAT sites within the promoter are not truly relevant in the transcriptional activation of MHC1.

This finding does not preclude the notion that the CaN-NFAT pathway is involved in regulating MHC1 promoter through an indirect mechanism. CsA was effective in altering the MHC1 promoter activity using an in vivo transfection approach. Other reports indicate that the CaN-NFAT pathway involvement in hypertrophy and slow muscle gene activation requires a collaborative interaction of various transcription factors. Full gene activation of slow isoforms, such as slow troponin I, as well as that of myoglobin, in C2C12 skeletal muscle cells was mediated through an NFAT-binding site in combination with CCAC and myocyte enhancer factor-2 motifs (6). Likewise, the interaction of NFAT with another transcription factor, GATA-4, was essential for full activation of the {beta}-natriuretic peptide promoter in primary rat cardiomyocytes (22). With this in mind, other CaN-NFAT-responsive regulatory factors that have binding sites in the MHC1 promoter may confer the CsA response.

Other genes in nonmuscle cells are also sensitive to CsA treatment. Pancreatic acinar-derived culture cells (29) showed diminished growth with CsA treatment due to a reduction of cyclin D1 mRNA and protein expression; also the activity of the cyclin D1 reporter gene was greatly decreased with CsA. GMSA and mutation analysis demonstrated that the CsA-sensitive region is a cAMP-responsive element (CRE). So CsA effectively diminished promoter activity by acting through the CRE pathway, with decreased CRE-protein binding activity likely caused by lower levels of CRE-binding protein (29). Similarly, in the regulation of the human insulin gene in {beta}-cells (23), cAMP- and membrane deplorization-induced stimulation of gene activity was sensitive to FK506 and CsA treatment; this sensitivity depended on intact CREs within the gene promoter. Therefore, MHC1 regulation may be similar to these reports describing the CRE-binding protein-mediated regulation of genes, suggesting that other factors may be involved, which are directly responsive to CsA, i.e., independent of the CaN-NFAT pathway.

The relationship between the slow muscle program and the CaN-NFAT pathway remains unresolved. In support of this relationship, Kubis et al. (19) linked a specific pattern of electrostimulation to the induction of slow MHC1 mRNA with nuclear import of NFATc1 in rabbit primary skeletal muscle culture, whereas Swoap et al. (32) demonstrated in C2C12 myoblasts that overexpression of activated CaN was associated with increased expression of reporter genes and endogenous genes of both slow and fast muscle isoforms. Overexpression of NFAT2 did not induce a reporter gene of fast (SERCA1) or slow (myosin light chain 2 slow) muscle isoforms, indicating that CaN may be involved in the regulation of skeletal muscle genes but not through NFAT. A recent paper by Parsons et al. (25) markedly demonstrates this notion of the disassociation of CaN and NFAT regulation on the muscle fiber phenotype. CaN catalytic genes CaN-A{alpha} and -A{beta} are both expressed in skeletal muscle. Examination of the soleus muscle of a CaN-A{alpha}-null transgenic mouse model showed a reduction in NFAT promoter activity and NFAT nuclear translocation, yet had no effect on the soleus MHC phenotype expression, whereas the soleus of a CaN-A{beta}-null transgenic mouse showed a marked decrease in slow type I fibers and an increase in fast type IIb fibers but exhibited no change in the NFAT activity or nuclear occupancy. The authors conclude that, although CaN may regulate the expression of MHC phenotype, it likely does so by an NFAT-independent mechanism (25).

Serrano et al. (30) showed that 7-day treatment of CaN inhibitors CsA, FK506, or CAIN prevented the normal induction of MHC1 expression after injury and regeneration of soleus muscle. Likewise, using cross sections of intact adult soleus muscles, in situ hybridization showed that those fibers strongly immunoreactive to the transfected CaN inhibitor CAIN were associated with predominance of MHC2x and MHC2b isoforms. Also, the activity of the –1,145-bp MHC1 promoter in intact soleus muscle was inhibited by CsA and FK506 (30). Similarly, we report that short-term CsA treatment caused a reduction in MHC1 promoter activity in vivo. However, after further examination of the promoter and NFAT-containing sequences, we concluded that NFAT does not appear to directly contribute to MHC1 promoter activity. Using RT-PCR rather than in situ hybridization, we also demonstrated that CaN inhibition resulted an upregulation of the endogenous fast-type MHC2a and MHC2x isoforms. However, unlike Serrano et al., the present report showed that CsA treatment had no effect on MHC2b expression or MHC1 pre- and mature mRNA expression in soleus muscles. It is possible that our findings differ somewhat from those of Serrano et al. because of the type of CaN inhibitor employed (we used CsA and they transfected soleus muscles with a CAIN expression plasmid), or perhaps there is a difference in the precision of the two mRNA detection methods. Alternatively, differences may be due to the different strain and age of the rat models used.

It is not clear in the present report why CsA treatment caused a decrease in the activity of the –3,500 promoter but did not cause a change in the level of the endogenous MHC1 pre- or mature mRNA. It is possible that 9 days of treatment with CsA is enough time to detect changes in the exogenous promoter expression and the de novo induction of fast MHC types but not enough to affect the predominant expression of the MHC1 isoform. Yet, despite the fact that the effect of CsA on the MHC1 promoter and MHC2x expression was statistically significant, the effect was not a major shift in the expression profile of intact soleus muscle. Perhaps the impact of the CaN pathway on the MHC phenotype in vivo is not as great as that suggested by the in vitro studies. Because the MHC is a keystone protein in the contractile unit and MHC1 is the predominant isoform that defines the slow phenotype in chronically active antigravity muscles, the findings reported herein and in other studies (25, 32) do not support the dogma, first put forth by Chin et al. (6), that the maintenance of the slow muscle gene program depends on the CaN-NFAT pathway. Clearly, more research is needed to ascertain the regulatory factors that control gene expression, which define a slow phenotype, especially those impacting the MHC gene family of proteins.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was done during the tenure of a fellowship for J. M. Giger from the Giannini Family Foundation and was supported by National Institute of Arthritis and Musculoskeletal and Skin Diseases Grant AR-30346.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. M. Giger, Dept. of Physiology & Biophysics, Univ. of California, Irvine, D-328, Med Sci I, Irvine, CA 92697 (E-mail: jmeehan{at}uci.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Adams GR, Haddad F, McCue SA, Bodell PW, Zeng M, Qin L, Qin AX, and Baldwin KM. Effects of spaceflight and thyroid deficiency on rat hindlimb development. II. Expression of MHC isoforms. J Appl Physiol 88: 904–916, 2000.[Abstract/Free Full Text]
  2. Bacou F, Rouanet P, Barjot C, Janmot C, Vigneron P, and d'Albis A. Expression of myosin isoforms in denervated, cross-innervated, and electrically stimulated rabbit muscles. Eur J Biochem 236: 539–547, 1996.[Web of Science][Medline]
  3. Bigard X, Sanchez H, Zoll J, Mateo P, Rousseau V, Veksler V, and Ventura-Clapier R. Calcineurin co-regulates contractile and metabolic components of slow muscle phenotype. J Biol Chem 275: 19653–19660, 2000.[Abstract/Free Full Text]
  4. Blough E, Dineen B, and Esser KA. Extraction of nuclear proteins from striated muscle tissue. Biotechniques 26: 202–204, 1999.[Web of Science][Medline]
  5. Caiozzo VJ, Baker MJ, McCue SA, and Baldwin KM. Single-fiber and whole muscle analyses of MHC isoform plasticity: interaction between T3 and unloading. Am J Physiol Cell Physiol 273: C944–C952, 1997.[Abstract/Free Full Text]
  6. Chin ER, Olson EN, Richardson JA, Yang Q, Humphries C, Shelton JM, Wu H, Weiguang Z, Bassel-Duby R, and Williams RS. A calcineurin-dependent transcriptional pathway controls skeletal muscle fiber type. Genes Dev 12: 2499–2509, 1998.[Abstract/Free Full Text]
  7. Chomoczynski P and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159, 1987.[Web of Science][Medline]
  8. Crabtree GR. Generic signals and specific outcomes: signaling through Ca2+, calcineurin, and NFAT. Cell 96: 611–614, 1999.[CrossRef][Web of Science][Medline]
  9. Giger J, Haddad F, Qin A, and Baldwin KM. In vivo regulation of the {beta}-myosin heavy chain in soleus muscle of suspended and weight-bearing rats. Am J Physiol Cell Physiol 278: C1153–C1161, 2000.[Abstract/Free Full Text]
  10. Giger J, Haddad F, Qin A, and Baldwin KM. Functional overload increases {beta}-MHC promoter activity in rodent fast muscle via the proximal MCAT ({beta}3) site. Am J Physiol Cell Physiol 282: C518–C527, 2002.[Abstract/Free Full Text]
  11. Haddad F, Arnold C, Zeng M, and Baldwin KM. Interaction of thyroid state and denervation on skeletal myosin heavy chain expression. Muscle Nerve 20: 1487–1496, 1997.[CrossRef][Web of Science][Medline]
  12. Haddad F, Herrick RE, Adams GR, and Baldwin KM. Myosin heavy chain expression in rodent skeletal muscle: effects of exposure to zero gravity. J Appl Physiol 75: 2471–2477, 1997.
  13. Haddad F, Qin A, Zeng M, McCue SA, and Baldwin KM. Interaction of hyperthyroidism and hindlimb suspension on skeletal myosin heavy chain expression. J Appl Physiol 85: 2227–2266, 1998.[Abstract/Free Full Text]
  14. Haddad F, Roy RR, Zhong H, Edgarton VR, and Baldwin KM. Atrophy responses to muscle inactivity. II. Molecular markers of protein deficits. J Appl Physiol 95: 791–802, 2003.[Abstract/Free Full Text]
  15. Hämäläinen N and Pette D. Slow-to-fast transitions in myosin expression of rat soleus muscle by phasic high-frequency stimulation. FEBS Lett 399: 220–222, 1996.[CrossRef][Web of Science][Medline]
  16. Hogan PG, Chen L, Nardone J, and Rao A. Transcriptional regulation by calcium, calcineurin, and NFAT. Genes Dev 17: 2205–2232, 2003.[Free Full Text]
  17. Huey KA, Haddad F, Qin A, and Baldwin KM. Transcriptional regulation of the type I myosin heavy chain gene in denervated rat soleus. Am J Physiol Cell Physiol 284: C738–C748, 2003.[Abstract/Free Full Text]
  18. Kirschbaum BJ, Kucher HB, Termir A, Kelly AM, and Pette D. Antagonistic effects of chronic low frequency stimulation and thyroid hormone on myosin expression in rat fast-twitch muscle. J Biol Chem 265: 13974–13980, 1990.[Abstract/Free Full Text]
  19. Kubis HP, Scheibe RJ, Meißner JD, Hornung G, and Gros G. Fast-to-slow transformation and nuclear import/export kinetics of the transcription factor NFATc1 during electrostimulation of rabbit muscle cells in culture. J Physiol 541: 835–847, 2002.[Abstract/Free Full Text]
  20. Lai MM, Burnett PP, Wolosker H, Blackshaw S, and Snyder SH. CAIN, a novel physiologic protein inhibitor of calcineurin. J Biol Chem 273: 18325–18331, 1998.[Abstract/Free Full Text]
  21. McLean BG, Lee KS, Simpson PC, and Farrance IKG. Basal and {alpha}1-adrenergic-induced activity of minimal rat {beta} MHC promoters in cardiac myocytes requires multiple TEF-1 but not NFAT binding sites. J Mol Cell Cardiol 35: 461–471, 2003.[CrossRef][Web of Science][Medline]
  22. Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, and Olson EN. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 93: 215–228, 1998.[CrossRef][Web of Science][Medline]
  23. Oetjen E, Grapentin D, Blume R, Seeger M, Krause D, Eggers A, and Knepel W. Regulation of human insulin gene transcription by the immunosuppressive drugs cyclosporin A and tacrolimus at concentrations that inhibit calcineurin activity and involving the transcription factor CREB. Naunyn Schmiedebergs Arch Pharmacol 367: 227–236, 2003.[CrossRef][Web of Science][Medline]
  24. Olson EN and Williams RS. Remodeling muscles with calcineurin. Bioessays 22: 510–519, 2000.[CrossRef][Web of Science][Medline]
  25. Parsons SA, Wilkins BJ, Bueno OF, and Molkentin JD. Altered skeletal muscle phenotypes in calcineurin A{alpha} and A{beta} gene-targeted mice. Mol Cell Biol 23: 4331–4343, 2003.[Abstract/Free Full Text]
  26. Pette D and Vrbova G. Adaptation of mammalian skeletal muscle fibers to chronic electrical stimulation. Rev Physiol Biochem Pharmacol 120: 115–202, 1992.[Web of Science][Medline]
  27. Rao A, Luo C, and Hogan PG. Transcription factors of the NFAT family: regulation and function. Annu Rev Immunol 15: 707–747, 1997.[CrossRef][Web of Science][Medline]
  28. Schiaffino S and Reggiani C. Myosin isoforms in mammalian skeletal muscle. J Appl Physiol 77: 493–501, 1994.[Abstract/Free Full Text]
  29. Schneider G, Oswald F, Wahl C, Greten FR, Adler G, and Schmid RM. Cyclosporine inhibits growth through the activating transcription factor/cAMP-responsive element-binding protein binding site in the cyclin D1 promoter. J Biol Chem 277: 43599–43607, 2002.[Abstract/Free Full Text]
  30. Serrano AL, Murgia M, Pallafacchina G, Calabria E, Coniglio P, Lømo T, and Schiaffino S. Calcineurin controls nerve activity-dependent specification of slow skeletal muscle fibers but not muscle growth. Proc Natl Acad Sci USA 98: 13108–13113, 2001.[Abstract/Free Full Text]
  31. Swoap SJ, Haddad F, Caiozzo VJ, Herrick RE, McCue SA, and Baldwin KM. Interaction of thyroid hormone and functional overload on skeletal muscle isomyosin expression. J Appl Physiol 77: 621–629, 1994.[Abstract/Free Full Text]
  32. Swoap SJ, Hunter RB, Stevenson EJ, Mitchell-Felton H, Kansagra NV, Lang JM, Esser KA, and Kandarian SC. The calcineurin-NFAT pathway and muscle fiber-type gene expression. Am J Physiol Cell Physiol 279: C915–C924, 2000.[Abstract/Free Full Text]
  33. Wright CE, Haddad F, Bodell PW, and Baldwin KM. In vivo regulation of the {beta} myosin heavy chain gene in rodent heart: role of thyroid hormone and evidence for an upstream enhancer. Am J Physiol Cell Physiol 276: C883–C891, 1999.[Abstract/Free Full Text]
  34. Wright CE, Haddad F, Qin A, and Baldwin KM. Analysis of myosin heavy chain mRNA expression by RT-PCR. J Appl Physiol 83: 1389–1396, 1997.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. Giger, A. X. Qin, P. W. Bodell, K. M. Baldwin, and F. Haddad
Activity of the beta-myosin heavy chain antisense promoter responds to diabetes and hypothyroidism
Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H3065 - H3071.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
Y.-C. Huang, R. G. Dennis, and K. Baar
Cultured slow vs. fast skeletal muscle cells differ in physiology and responsiveness to stimulation
Am J Physiol Cell Physiol, July 1, 2006; 291(1): C11 - C17.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. Banzet, N. Koulmann, N. Simler, O. Birot, H. Sanchez, R. Chapot, A. Peinnequin, and X. Bigard
Fibre-type specificity of interleukin-6 gene transcription during muscle contraction in rat: association with calcineurin activity
J. Physiol., August 1, 2005; 566(3): 839 - 847.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Giger, J. M.
Right arrow Articles by Baldwin, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Giger, J. M.
Right arrow Articles by Baldwin, K. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.