|
|
||||||||
Department of Physiology and Biophysics, University of California, Irvine, California 92697
Submitted 23 July 2003 ; accepted in final form 18 March 2004
| ABSTRACT |
|---|
|
|
|---|
rat; soleus muscle; reverse transcription polymerase chain reaction; promoter; reporter; myosin heavy chain
) MHC isoform (MHC1) is typically expressed in slow muscles, which are characterized by a relatively slow speed of contraction but exhibit fatigue resistance and thus are able to maintain contractile activity for long periods of time. They typically function as weight-bearing and postural muscles. In the rat soleus, a slow muscle in the hindlimb,
90% of fibers express MHC1 (11, 15). The relationship between weight-bearing activity and the expression of MHC1 in soleus muscle is demonstrated by removing the factor of load in experimental animal models, achieved by subjecting the animal to either the microgravity environment of spaceflight (12) or through hindlimb suspension (5) such that the leg muscles bear little or no weight. When these manipulations are imposed, the expression of MHC1 in soleus is significantly reduced with a shift toward faster MHC isoforms (5, 12). At the other extreme, chronic functional overload (via the removal of muscle synergists) induces the expression of MHC1 in the plantaris, a fast muscle that normally does not significantly express the type I isoform (31). Similar to the above-described variations in loading state, motor nerve input activity is also thought to play a key role in determining the muscle fiber phenotype. Mimicking the firing pattern characteristic of slow muscle nerves, chronic low-frequency stimulation of fast-twitch muscles induces a shift from fast to slower isoforms of MHC (26) and myosin light chain (2, 18) proteins. On the other hand, denervation, achieved by severing the sciatic nerve, eliminates the contractile activity of the soleus and results in a significant reduction in MHC1 expression and a concomitant increase in fast MHC isoforms (18). A greater degree of shift from slow to fast isoforms is also observed when soleus muscles are exposed to phasic high-frequency stimulation after denervation, which resembles the neural activity pattern of fast muscle nerves (15).
This plasticity of the MHC1 phenotype in response to environmental cues appears to be regulated by pretranslational (13, 31) and likely transcriptional processes (14, 17). However, the specific transcriptional mechanisms by which exogenous signals influence the expression of the MHC1 gene are unclear. A report in 1998 (6) implicated the calcineurin (CaN)-nuclear factor of activated T cells (NFAT) signaling pathway as the link between neural activity and the expression of slow isoforms in skeletal muscle. As described in several recent reviews (8, 16, 24, 27), CaN is an ubiquitous serine/threonine protein phosphatase and its activity is regulated by intracellular Ca2+ concentration. Activated CaN regulates NFAT function by the dephosphorylation of its regulatory domain, which triggers nuclear translocation and increases DNA-binding activity. Once translocated to the nucleus, the dephosphorylated NFAT activates transcription of specific genes. Rephosphorylation by certain nuclear kinases results in the export of NFAT from the nucleus. CaN activation can be inhibited by the binding of immunosuppressive drugs: cyclosporin A (CsA) or FK506.
The noteworthy report by Chin et al. (6) showed that, when the gene-promoter constructs of the slow-twitch muscle-specific slow troponin I isoform, as well as the oxidative myofiber-specific protein myoglobin, were transfected into Sol8 and C2C12 myocytes along with a constitutively active CaN expression vector, reporter activity increased significantly. Treatment with CsA as well as mutation of the NFAT sites in these promoters caused inhibition of the reporter activity. The authors concluded that the tonic neural activity pattern typical of slow muscle nerves sustains a level of intracellular Ca2+ that maintains CaN activity, which ultimately results in translocation of NFAT to the nucleus and subsequent binding to sites on the slow troponin I and myoglobin genes. Findings by Bigard et al. (3) further support the role of CaN in the expression of slow genes in vivo by showing a decrease in the expression of two slow isoforms of muscle-specific proteins, MHC1 and sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) 2a, and an increase in fast isoforms, MHC2a and SERCA1, in soleus muscle of rats treated with CsA for 3 wk.
An interesting rat study by Serrano et al. (30) showed that the expression of the MHC1 protein in regenerating and normal soleus muscle was blocked by CaN inhibitors CsA, FK506b, and CaN-inhibiting peptide [CAIN; a novel protein that interacts with the catalytic domain of CaN, inhibiting its activity (20)]. Also, the reporter activity of a 1,145-bp MHC1 promoter showed a robust decrease in response to CsA in normal soleus muscle. Moreover, in normal adult soleus muscles, transfection of a CAIN expression vector was associated with the expression of fast MHC2x and MHC2b transcripts, but not slow MHC1 or MHC2a transcripts, as detected by in situ hybridization. This report concluded that CAIN not only prevented a fast-to-slow MHC transformation in regenerating fibers but induced a switch from slow to fast MHC in normal soleus muscle. Therefore, Serrano et al. contend that the CaN pathway is involved in the maintenance as well as the induction of slow MHC expression in slow-type fibers.
We are interested in determining the regulatory factors that control MHC1 expression. In previous studies (9, 10), we injected a rat MHC1 promoter-reporter construct into soleus muscles. The reporter gene expression mimics the functional and fiber type-specific pattern as the endogenous type I gene. We determined through deletion analysis that the highest level of promoter activity that we measure depends on the presence of a 550-bp upstream "enhancer." The presence or absence of the enhancer did not affect promoter activity in fast-type plantaris muscle (10), suggesting that the enhancer region is only relevant in slow muscle. In light of the recent findings implicating the CaN-NFAT pathway in the regulation of the slow muscle fiber gene program, particularly the effect of CsA on the MHC1 promoter (30), the present report aims to test the hypothesis that this pathway is responsible for the relatively high level of reporter activity observed in normal soleus muscle when the enhancer region of the MHC1 promoter is present. The question as to whether those reported CaN effects on slow muscle gene expression (3, 6, 30) are in fact due to the direct binding of NFAT factors to the promoter can be examined with promoter analysis. Phase 1 of this study examined the sequence of the MHC1 promoter to identify any potential NFAT response elements (NREs) within the promoter. Then, in combination with treatment of the CaN inhibitor CsA, deletion analysis was performed to determine whether the enhancer region of the promoter contained essential NREs responsible for the promoter activity or CsA sensitivity. Phase 2 of the study entailed the mutation of specific NREs in the relevant CsA-sensitive region of the promoter. Phase 3 examined how the transcriptional or pretranslational activity of the endogenous MHC I gene responded to CsA treatment.
Our findings suggest that CsA treatment caused a significant decrease (>30%) in the reporter activity of only the 3,500 and 3,450 MHC1-firefly luciferase (Fluc) promoters in soleus muscle. However, 2,900 and smaller deletion promoters were not affected. Mutating the NREs in the upstream region of the promoter had no substantial effect on promoter activity. Subsequent examination of the endogenous MHC1 pre-mRNA expression showed no difference between vehicle- and CsA-treated rats, suggesting that transcriptional activity of endogenous type I gene may occur independently of NFAT. Thus, although it is possible that CsA affects the activity of MHC1 promoter, its effect may not act directly through NFAT binding sites on the MHC1 promoter.
| METHODS |
|---|
|
|
|---|
Plasmid construction was as described previously (9). The 3,500 and all shorter promoter fragments and specific mutations were subcloned by standard procedures into the reporter plasmid, a Fluc expression vector (pGL3 basic, Promega). All MHC1 sequences terminated at +34 from the transcription start site. A 2-kb promoter sequence of the human skeletal
-actin (gift from S. Swoap, Williams College) linked to a renilla luciferase reporter was used as the reference vector (9). Mutation constructs 3,500dNFATmut and 3,500pNFATmut consisted of a five-base substitution in the 3,500 MHC1 promoter designed to disrupt binding of NFAT to the targeted site in the promoter. Custom primers (Invitrogen, Carlsbad, CA) were used for mutagenesis (QuikChange Site-Directed Mutagenesis Kit, Stratagene) using the 3,500 wild-type sequence as a template. TESS database (http://www.cbil.upenn.edu/tess) was originally used to identify transcription-factor binding sites. This type of in silico analysis screens the test sequence and highlights possible matches of the sequence and gives the percent fidelity to known consensus sequences. Highlighted matches of interest are then compared with published consensus sequences. See Table 1 for sequences for NFAT mutation.
|
CsA injection. Female Sprague-Dawley rats weighing 100115 g were administered 20 mg/kg CsA (Sandimmune, Novartis). Control rats were administered the CsA vehicle, consisting of 67% cremophor EL (Sigma Chemical) and 33% ethanol. Both CsA and vehicle solutions were diluted in 0.9% saline and injected intraperitoneally in rats once daily for 9 days. At the end of the experimental period, blood samples were taken, and CsA levels were assessed by the Pathology Department of the University of California Irvine Medical Center. All samples that were analyzed showed blood CsA levels exceeding 1,000 ng/ml (vehicle-treated rats, <25 ng/ml). After the 9 days, soleus muscle tissues used for nuclear extraction were excised after pentobarbital sodium (100 mg/kg) euthanasia, quick frozen, and stored at 80°C for RNA analysis.
DNA injection.
On the third day of the treatment period, rats were anesthetized (10 mg ketamine-20 mg acepromazine per 100 g) for aseptic surgical-injection procedures. A skin incision was made to expose the soleus muscle. Twenty microliters of PBS containing a mixture of two supercoiled DNA plasmids [
-MHC test plasmid (molar equivalent to 10 µg of 3,500-bp MHC-Fluc) and a control skeletal
-actin linked to a renilla luciferase reporter plasmid (molar equivalent to 5 µg of 3,500-bp MHC-Fluc)] were injected into the muscle with a 29-gauge needle attached to a 0.5-ml insulin syringe. Seven days after plasmid injection (9th day of treatment), soleus muscle tissues were excised after pentobarbital sodium (100 mg/kg) euthanasia, quick frozen, and stored at 80°C. All animals in the study were allowed food and water ad libitum, and all procedures were approved by the institutional animal care and use committee.
Reporter Expression Assay
Frozen muscle tissues were homogenized in ice-cold passive lysis buffer from Promega by use of a glass homogenizer. The homogenate was centrifuged at 10,000 g for 10 min at 4°C. The supernatant was reserved for the luciferase activity assay using Promega's Dual Luciferase Assay kit, which is designed for sensitive detection of both Fluc and renilla luciferase activities in a single-extract aliquot. Activities were measured as total light output (as measured by a Monolight 2010-C luminometer) per muscle per second and were expressed as relative light units. Background levels, based on luciferase activities of noninjected tissue, were subtracted from the activities of test samples. These experiments were predicated on the assumption that the level of luciferase activity is proportional to the degree of promoter activity.
Nuclear Extraction of Skeletal Muscle Tissue
Nuclear protein was extracted from skeletal muscle according to the method described by Blough et al. (4). Briefly, frozen soleus muscle tissue (
200300 mg) was homogenized in 35 ml of buffer 1 (10 mM HEPES, pH 7.5; 10 mM MgCl2; 5 mM KCl; 0.1 mM EDTA, pH 8.0; 0.1% Triton X-100; 0.2 mM PMSF, 2.5 µg/ml aprotinin, 2.5 µg/ml leupeptin, 1 mM DTT). Homogenates were centrifuged for 5 min at 3,000 g at 4°C. The pellets were resuspended in 5001,000 µl of buffer 2 (20 mM HEPES, pH 7.5; 500 mM NaCl; 1.5 mM MgCl2; 0.2 mM EDTA, pH 8.0; 25% glycerol; 0.2 mM PMSF, 2.5 µg/ml aprotinin, 2.5 µg/ml leupeptin, 0.5 mM DTT). Suspension was incubated on ice with intermittent mixing for 30 min and centrifuged for 5 min at 4,000 g at 4°C. The supernatant was transferred to an Amicon 2-ml Centricon filter unit (YM-10; Millipore, Bedford, MA). An equal volume of binding buffer (20 mM HEPES, pH 7.9; 40 mM KCl; 2 mM MgCl2; 10% glycerol; 0.2 mM PMSF, 2.5 µg/ml aprotinin, 2.5 µg/ml leupeptin, 0.5 mM DTT) was added to the filter unit and centrifuged for 30 min at 4,500 g at 4°C. Another 5001,000 µl were added and centrifuged again for 3 min, and centrifugation was repeated until concentrate achieved the desired volume (1 ml). Protein concentration of nuclear extract was determined by using the Bio-Rad protein assay with BSA as a standard. Nuclear extract samples were stored at 80°C.
Gel Mobility Shift Assay
Gel mobility shift assays (GMSAs) were used to examine binding of nuclear extract protein to the dNFAT and pNFAT cis-regulatory element of the rat MHC1 gene promoter. All oligonucleotide sequences were purchased from Invitrogen Life Technologies (Carlsbad, CA). The sequences of the sense strand are dNFAT 5': AATCCTTGGAAAAACCCACCTTGAC 3'; dNFATmut5': AATCCTTAACGCAACCCACCTTGAC 3'; pNFAT 5': CTGTGGAAAGCAGAGATTGGGAGAA 3'; pNFAT mut5': CTGTAACGCGCAGAGATTGGGAGAA; and unrelated: 5' GTTAAGTGACTGAGCTAGACCACAC 3'. Underlined are bases that were mutated. The mutant sequences of dNFAT and pNFAT contain the same 5-bp mutation as that used in the promoter studies (Table 1). After strand annealing, the double-stranded probe was end labeled with [
-32P]ATP (6,000 Ci/mmol) using T4 polynucleotide kinase (New England Biolabs, Beverly, MA). For each binding reaction, 20 µg of a control soleus nuclear extract were preincubated for 10 min at room temperature with 225 ng of poly(dI-dC) homopolymer, which was used as a nonspecific competitor, in a binding buffer containing 40 mM KCl, 1 mM DTT, 1 mM EDTA, 1 mM MgCl2, 7.5% glycerol, 0.05% BSA, and 20 mM HEPES, pH 7.9, in a total volume of 20 µl. For competition studies, the preincubation was carried out in the presence of 150x molar excess of either cold dNFAT or pNFAT weight (self), a cold mutated dNFAT or pNFAT, or unrelated MHC1 promoter oligonucleotide (nonspecific). At the end of the preincubation, 100,000 cpm of labeled dNFATwt, dNFATmut, pNFATwt, or pNFATmut were added and incubated for 30 min at room temperature. In some cases, 2 µl of NFATc1 monoclonal antibody (Affinity Bioreagents, Golden, CO) were added 15 min after incubation with the probe, and incubation was continued for 15 min more. At the end of the reaction, 2 µl of loading buffer (20% Ficoll, 0.2% bromophenol blue, and 0.2% xylene cyanol) were added, and the reaction mixtures were loaded on a 6% polyacrylamide gel, which was preelectrophoresed at 20 mA/gel for 2 h. Electrophoresis was carried out in 0.5x Tris-borate/EDTA buffer at constant current (30 mA) at room temperature for 3 h. After electrophoresis, the gels were dried, and the bands were visualized by phosphorimaging (Molecular Dynamics, Sunnyvale, CA).
MHC RNA Analyses
Total RNA isolation. Total RNA was extracted from preweighed frozen muscle samples with the use of TRI Reagent (Molecular Research Center, Cincinnati, OH) according to the protocol supplied by the manufacturer, which is based on the method described by Chomczynski and Sacchi (7). Extracted RNA was precipitated from the aqueous phase with isopropanol, and after a wash with ethanol, it was dried and suspended in a small volume of nuclease-free water. All RNA samples used for these analyses were treated with DNase (Promega) to remove any trace of genomic DNA contamination. After DNase treatment, the RNA samples were reextracted with Tri Reagent liquid sample kit (Molecular Research Center), and the RNA pellet was suspended in nuclease-free water. The RNA concentration was determined by ultraviolet absorption at 260 nm, and the samples were stored at 80°C for subsequent analysis with RT-PCR.
RT. One microgram of total RNA was reverse transcribed for each muscle sample with the use of the SuperScript II RT from Invitrogen and a mix of oligo(dT) (100 ng/reaction) and random primers (200 ng/reaction) in a 20-µl total reaction volume at 45°C for 50 min, according to the provided protocol. At the end of the RT reaction, the tubes were heated at 90°C for 5 min to stop the reaction and then were stored at 80°C until they were used in the PCR reactions for specific MHC mRNA analyses (see below).
PCR. A relative RT-PCR method using 18S as an internal standard (Ambion, Austin, TX) was applied to study the expression of specific MHC mRNAs. Sequences for the various primers used for the specific target mRNAs is shown in Table 2. In each PCR reaction, 18S ribosomal RNA was coamplified with the target cDNA (mRNA) to serve as an internal standard and to allow correction for differences in starting amounts of total RNA. For the 18S amplification, we used the Alternate 18S internal standard (Ambion), which yields a 324-bp product. The 18S primers were mixed with competimers at an optimized ratio of 3 to 1. Inclusion of 18S competimers was necessary to attenuate the 18S signal, which allows its linear amplification to the same range as the coamplified target mRNA (Ambion, relative RT-PCR kit protocol).
|
Analyses of type I MHC pre-mRNA. For specifically targeting the type I mRNA and pre-mRNA, we used a selective RT-PCR approach by which only the targeted RNA species are reverse transcribed and amplified. Thus, for each sample, 1 µg of total RNA was reverse transcribed by Superscript II (Invitrogen) and MHC1 mRNA-specific antisense primer (RT primer in Table 1). This specific RT reaction was followed by specific amplification of both the mRNA and pre-mRNA. The PCR for amplification of MHC1 mRNA used primers 1 and 2 and 1 µl of cDNA template diluted 40-fold and was carried out for 24 cycles, which resulted in a 546-bp PCR product. PCR to amplify MHC1 pre-mRNA was similar to the above except that the cDNA dilutions were only fivefold. The primers used were primers 3 and 4, and the number of cycles was raised to 30. This resulted in a 186-bp product. Primer 3 is derived from the last intron of the MHC1 gene. Thus this primer can target only pre-mRNA. The number of cycles and the PCR conditions for each target mRNA were optimized so that the amplified signal was still on the linear portion of a semi-log plot of the yield expressed as a function of the number of cycles. As a check for genomic DNA contamination, PCR reactions were carried out with an equal amount of non-RT RNA. These reactions turned out negative, thus validating the effectiveness of DNase treatment. PCR products were separated on a 2% agarose gel by electrophoresis, and they were stained with ethidium bromide. The signal quantification was conducted by laser-scanning densitometry as reported previously (34).
Note that in this procedure it is not possible to normalize the signal to a reference RNA standard because the RT reaction was selective to MHC1 RNA/pre-mRNA. Accuracy and precision are important for such a determination. To keep the processing variability to a minimum, all samples (control and experimental) were processed at the same time, under identical conditions, and used the same premixed reagents to ensure homogeneity. Also, all samples were run in duplicates.
Statistical Analysis
Statistical analysis was performed with the Graphpad Prism 4.0 statistical software package. Values are means ± SE. Differences between the means of two experimental groups were assessed by an unpaired, two-tailed t-test. P < 0.05 was taken as the level of statistical significance.
| RESULTS |
|---|
|
|
|---|
Examination of putative regulatory sites in the 3,500 MHC1 promoter using the TESS database revealed nine potential NFAT sites within the promoter (Fig. 1), with three of these sites located in the enhancer region (9). It is possible that the CaN-NFAT cascade is responsible for maintaining the MHC I promoter activity that we observe routinely in soleus muscle (9, 10). To test the hypothesis that CaN-activated NFAT regulates reporter gene expression by interacting directly with NFAT sites on the promoter, we examined reporter activity after treatment with the CaN inhibitor CsA. Compared with vehicle-treated rats, the activity of the 3,500 promoter was significantly reduced after 9 days of CsA treatment (Fig. 1). Because the locations of the nine putative sites are interspersed throughout the length of the promoter, deletion analysis was performed to determine which segment(s) of the promoter contains the relevant NFAT site(s). Deleting 50 bp from 3,500 eliminated the most distal putative NFAT (at 3,470); yet the reporter activity of this 3,450 promoter was similar to that of the 3,500 promoter and still responded to CsA.
|
Mutation of NREs Does Not Affect Promoter Activity
To determine whether the two remaining NFAT sites at 3,389 and 3,049 are responsible for conferring the enhanced reporter activity and CsA sensitivity of the 3,500 promoter, these sites were mutated individually in the 3,500 promoter (Fig. 2). We hypothesized that, if one or both of these putative NFAT sites were required for the CsA response, their mutation would cause the promoter activity of both the vehicle-treated and the CsA-treated groups to be reduced to a similar level as the CsA-treated wild-type 3,500 promoter. However, the reporter activity of the 3,500 pNFATmut (at 3,049, the more proximal NFAT site of the two) mutant construct in vehicle- and CsA-treated rats was similar to that of the wild-type 3,500 promoter. Likewise, although there is a significant upregulation in reporter activity of the 3,500 dNFATmut (more distal NFAT 3,389) construct in vehicle-treated rats compared with that of the wild-type 3,500 promoter, this mutant is still responsive to CsA. A double mutant was created, which contained mutations of both proximal and distal NFAT sites to test whether there is a cooperative effect requiring both of the NFAT sites to be intact. Promoter activity of the double mutant was similar to that of the dNFAT construct alone. Therefore, the mutation analyses indicate that neither the dNFAT nor the pNFAT elements are responsible for maintaining MHC1 promoter activity in soleus or its sensitivity to CsA. Subsequently, an additional deletion, 3,100, was tested and found to act similarly to the 3,500 promoter in vehicle-treated rats but did not show a significant reduction due to CsA treatment. Comparing deletion sequences, it appears that the minimum promoter length for highest measured activity is 3,100, indicating that the enhancer is located between 2,900 and 3,100 but also that the CsA responsiveness is upstream, between 3,100 and 3,450.
|
GMSAs were performed to verify that the dNFAT and pNFAT promoter sites that were mutated in the above-described promoter assays were indeed specific NFAT binding sites and to verify that the mutations were effective in disrupting NFAT binding. Double-stranded oligonucleotides corresponding to the dNFAT (Fig. 3A) or pNFAT (Fig. 3B) sequences were radiolabeled and examined in GMSAs with nuclear protein extracts from control soleus muscles as specified in METHODS. Several dark and light bands are resolved in both gels (Fig. 3), likely because of the less stringent conditions of the nuclear extraction method (4). However, there are specific binding complexes designated. Specificity was determined if bands were disrupted by competition with unlabeled self (lane 3) and were not detected when incubated with the radiolabeled mutant NFAT probe (lane 2) but were not competed by nonself oligonucleotides: NFATmut (lane 4) or unrelated sequence (lane 5). Addition of NFATc1 antibody (lane 6) disrupts the banding pattern, confirming that the sequence contains an NFAT recognition site. Therefore, these assays suggest that control soleus extracts likely contain an NFAT protein, which binds these dNFAT and pNFAT sequences in vitro. However, the promoter mutation analyses in vivo indicate that these NFAT sites are not relevant in conferring transcriptional activity of the MHC1 promoter.
|
Based on the notion that, by inhibiting CaN-NFAT cascade, CsA can inhibit the slow muscle gene program as determined by mRNA levels (3, 6), endogenous mRNA samples were also examined. Total RNA was isolated from soleus muscles of vehicle- and 9-day CsA-treated rats. RT-PCR analysis showed that CsA treatment was effective in inducing a change in the MHC mRNA profile of soleus muscles (Fig. 4). An increase in the relative level of MHC2a as well as an induction of MHC2x mRNA expression were detected in the soleus of CsA-treated rats. Against expectations, RT-PCR analyses of MHC1 mRNA indicated that CsA had no obvious impact on MHC1 expression relative to 18S (Fig. 4). We also adapted RT-PCR analysis by using a newly derived primer sequenced from the last intron of the MHC1 gene to examine levels of pre-mRNA as a gauge of transcriptional activity of the endogenous gene. Surprisingly, there was no change in the MHC1 pre-mRNA in response to CsA treatment (Fig. 5).
|
|
| DISCUSSION |
|---|
|
|
|---|
1-adrenergic stimulation. At least nine NFAT sites can be identified in the 3,500/+34 MHC1 promoter via in silico sequence analysis; three of these sites are confirmed NFAT elements (Ref. 21 and this report). However, it seems that the presence of these NFAT sites within the promoter are not truly relevant in the transcriptional activation of MHC1.
This finding does not preclude the notion that the CaN-NFAT pathway is involved in regulating MHC1 promoter through an indirect mechanism. CsA was effective in altering the MHC1 promoter activity using an in vivo transfection approach. Other reports indicate that the CaN-NFAT pathway involvement in hypertrophy and slow muscle gene activation requires a collaborative interaction of various transcription factors. Full gene activation of slow isoforms, such as slow troponin I, as well as that of myoglobin, in C2C12 skeletal muscle cells was mediated through an NFAT-binding site in combination with CCAC and myocyte enhancer factor-2 motifs (6). Likewise, the interaction of NFAT with another transcription factor, GATA-4, was essential for full activation of the
-natriuretic peptide promoter in primary rat cardiomyocytes (22). With this in mind, other CaN-NFAT-responsive regulatory factors that have binding sites in the MHC1 promoter may confer the CsA response.
Other genes in nonmuscle cells are also sensitive to CsA treatment. Pancreatic acinar-derived culture cells (29) showed diminished growth with CsA treatment due to a reduction of cyclin D1 mRNA and protein expression; also the activity of the cyclin D1 reporter gene was greatly decreased with CsA. GMSA and mutation analysis demonstrated that the CsA-sensitive region is a cAMP-responsive element (CRE). So CsA effectively diminished promoter activity by acting through the CRE pathway, with decreased CRE-protein binding activity likely caused by lower levels of CRE-binding protein (29). Similarly, in the regulation of the human insulin gene in
-cells (23), cAMP- and membrane deplorization-induced stimulation of gene activity was sensitive to FK506 and CsA treatment; this sensitivity depended on intact CREs within the gene promoter. Therefore, MHC1 regulation may be similar to these reports describing the CRE-binding protein-mediated regulation of genes, suggesting that other factors may be involved, which are directly responsive to CsA, i.e., independent of the CaN-NFAT pathway.
The relationship between the slow muscle program and the CaN-NFAT pathway remains unresolved. In support of this relationship, Kubis et al. (19) linked a specific pattern of electrostimulation to the induction of slow MHC1 mRNA with nuclear import of NFATc1 in rabbit primary skeletal muscle culture, whereas Swoap et al. (32) demonstrated in C2C12 myoblasts that overexpression of activated CaN was associated with increased expression of reporter genes and endogenous genes of both slow and fast muscle isoforms. Overexpression of NFAT2 did not induce a reporter gene of fast (SERCA1) or slow (myosin light chain 2 slow) muscle isoforms, indicating that CaN may be involved in the regulation of skeletal muscle genes but not through NFAT. A recent paper by Parsons et al. (25) markedly demonstrates this notion of the disassociation of CaN and NFAT regulation on the muscle fiber phenotype. CaN catalytic genes CaN-A
and -A
are both expressed in skeletal muscle. Examination of the soleus muscle of a CaN-A
-null transgenic mouse model showed a reduction in NFAT promoter activity and NFAT nuclear translocation, yet had no effect on the soleus MHC phenotype expression, whereas the soleus of a CaN-A
-null transgenic mouse showed a marked decrease in slow type I fibers and an increase in fast type IIb fibers but exhibited no change in the NFAT activity or nuclear occupancy. The authors conclude that, although CaN may regulate the expression of MHC phenotype, it likely does so by an NFAT-independent mechanism (25).
Serrano et al. (30) showed that 7-day treatment of CaN inhibitors CsA, FK506, or CAIN prevented the normal induction of MHC1 expression after injury and regeneration of soleus muscle. Likewise, using cross sections of intact adult soleus muscles, in situ hybridization showed that those fibers strongly immunoreactive to the transfected CaN inhibitor CAIN were associated with predominance of MHC2x and MHC2b isoforms. Also, the activity of the 1,145-bp MHC1 promoter in intact soleus muscle was inhibited by CsA and FK506 (30). Similarly, we report that short-term CsA treatment caused a reduction in MHC1 promoter activity in vivo. However, after further examination of the promoter and NFAT-containing sequences, we concluded that NFAT does not appear to directly contribute to MHC1 promoter activity. Using RT-PCR rather than in situ hybridization, we also demonstrated that CaN inhibition resulted an upregulation of the endogenous fast-type MHC2a and MHC2x isoforms. However, unlike Serrano et al., the present report showed that CsA treatment had no effect on MHC2b expression or MHC1 pre- and mature mRNA expression in soleus muscles. It is possible that our findings differ somewhat from those of Serrano et al. because of the type of CaN inhibitor employed (we used CsA and they transfected soleus muscles with a CAIN expression plasmid), or perhaps there is a difference in the precision of the two mRNA detection methods. Alternatively, differences may be due to the different strain and age of the rat models used.
It is not clear in the present report why CsA treatment caused a decrease in the activity of the 3,500 promoter but did not cause a change in the level of the endogenous MHC1 pre- or mature mRNA. It is possible that 9 days of treatment with CsA is enough time to detect changes in the exogenous promoter expression and the de novo induction of fast MHC types but not enough to affect the predominant expression of the MHC1 isoform. Yet, despite the fact that the effect of CsA on the MHC1 promoter and MHC2x expression was statistically significant, the effect was not a major shift in the expression profile of intact soleus muscle. Perhaps the impact of the CaN pathway on the MHC phenotype in vivo is not as great as that suggested by the in vitro studies. Because the MHC is a keystone protein in the contractile unit and MHC1 is the predominant isoform that defines the slow phenotype in chronically active antigravity muscles, the findings reported herein and in other studies (25, 32) do not support the dogma, first put forth by Chin et al. (6), that the maintenance of the slow muscle gene program depends on the CaN-NFAT pathway. Clearly, more research is needed to ascertain the regulatory factors that control gene expression, which define a slow phenotype, especially those impacting the MHC gene family of proteins.
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
-myosin heavy chain in soleus muscle of suspended and weight-bearing rats. Am J Physiol Cell Physiol 278: C1153C1161, 2000.
-MHC promoter activity in rodent fast muscle via the proximal MCAT (
3) site. Am J Physiol Cell Physiol 282: C518C527, 2002.
1-adrenergic-induced activity of minimal rat
MHC promoters in cardiac myocytes requires multiple TEF-1 but not NFAT binding sites. J Mol Cell Cardiol 35: 461471, 2003.[CrossRef][Web of Science][Medline]
and A
gene-targeted mice. Mol Cell Biol 23: 43314343, 2003.
myosin heavy chain gene in rodent heart: role of thyroid hormone and evidence for an upstream enhancer. Am J Physiol Cell Physiol 276: C883C891, 1999.This article has been cited by other articles:
![]() |
J. Giger, A. X. Qin, P. W. Bodell, K. M. Baldwin, and F. Haddad Activity of the beta-myosin heavy chain antisense promoter responds to diabetes and hypothyroidism Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H3065 - H3071. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Huang, R. G. Dennis, and K. Baar Cultured slow vs. fast skeletal muscle cells differ in physiology and responsiveness to stimulation Am J Physiol Cell Physiol, July 1, 2006; 291(1): C11 - C17. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Banzet, N. Koulmann, N. Simler, O. Birot, H. Sanchez, R. Chapot, A. Peinnequin, and X. Bigard Fibre-type specificity of interleukin-6 gene transcription during muscle contraction in rat: association with calcineurin activity J. Physiol., August 1, 2005; 566(3): 839 - 847. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |