Journal of Applied Physiology Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

J Appl Physiol 95: 1861-1866, 2003; doi:10.1152/japplphysiol.00326.2003
8750-7587/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wieneke, S.
Right arrow Articles by Jockusch, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wieneke, S.
Right arrow Articles by Jockusch, H.

Acute pathophysiological effects of muscle-expressed Dp71 transgene on normal and dystrophic mouse muscle

Sascha Wieneke,1 Peter Heimann,1 Sigalit Leibovitz,2 Uri Nudel,2 and Harald Jockusch1

1Developmental Biology and Molecular Pathology, Bielefeld University, D-33501 Bielefeld, Germany; and 2Molecular Cell Biology, The Weizmann Institute of Science, Rehovot 76100, Israel

Submitted 2 April 2003 ; accepted in final form 2 July 2003


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
products of the dystrophin gene range from the 427-kDa full-length dystrophin to the 70.8-kDa Dp71. Dp427 is expressed in skeletal muscle, where it links the actin cytoskeleton with the extracellular matrix via a complex of dystrophin-associated proteins (DAPs). Dystrophin deficiency disrupts the DAP complex and causes muscular dystrophy in humans and the mdx mouse. Dp71, the major nonmuscle product, consists of the COOH-terminal part of dystrophin, including the binding site for the DAP complex but lacks binding sites for microfilaments. Dp71 transgene (Dp71tg) expressed in mdx muscle restores the DAP complex but does not prevent muscle degeneration. In wild-type (WT) mouse muscle, Dp71tg causes a mild muscular dystrophy. In this study, we tested, using isolated extensor digitorum longus muscles, whether Dp71tg exerts acute influences on force generation and sarcolemmal stress resistance. In WT muscles, there was no effect on isometric twitch and tetanic force generation, but with a cytomegalovirus promotor-driven transgene, contraction with stretch led to sarcolemmal ruptures and irreversible loss of tension. In MDX muscle, Dp71tg reduced twitch and tetanic tension but did not aggravate sarcolemmal fragility. The adverse effects of Dp71 in muscle are probably due to its competition with dystrophin and utrophin (in MDX muscle) for binding to the DAP complex.

dystrophin; mdx mouse; sarcolemmal ruptures; eccentric contractions; mechanophysiology

THE DYSTROPHIN GENE of humans and mice codes for five transcripts of different lengths that arise from the activity of internal promoters: full-length dystrophin (Dp427) and the shorter polypeptides Dp260, Dp140, Dp116, and Dp71. Dp427 is a submembraneous cytoskeletal protein that consists of four domains with distinct functions: the NH2 terminal binds to F-actin, the central rod domain confers elasticity on the protein, the cysteine-rich domain binds to a complex of dystrophin-associated proteins, and the COOH terminal binds to cytoplasmatic syntrophin (5, 14). Because one of the dystrophin-associated proteins, {alpha}-dystroglycan, binds to laminin, dystrophin links the actin cytoskeleton to the extracellular matrix. Dystrophin deficiency causes muscular dystrophy, which is severely progressive in affected Duchenne patients but relatively benign in the MDX mouse. In MDX muscle, the autosomal homologue of dystrophin, utrophin, is upregulated and partially compensates for the loss of dystrophin (6, 18). The properties of dystrophin-deficient muscle cells suggests that an important function of dystrophin is to protect the sarcolemma against mechanical stress during contraction (13, 15); yet, an additional signaling role is likely (16).

Dp71 consists of the cysteine-rich and COOH-terminal domains of dystrophin and lacks binding sites for the cytoplasmic microfilaments. It is the major nonmuscle product that is absent from skeletal muscle and particularly abundant in the central nervous system. In neurons and glial cells, it occurs in at least two splice isoforms with different subcellular localizations (12). The cellular function of Dp71 remains to be elucidated.

Dp71 transgene (Dp71tg) expressed in MDX muscle restored the dystrophin-associated protein complex but did not prevent muscle degeneration (4, 7). In a previous study (10), a deleterious effect of a muscle-expressed Dp71tg in wild-type mice was documented by degeneration and regeneration and elevated levels of plasma creatine kinase, i.e., long-term and steady-state symptoms of muscular dystrophy.

In this study, we tested, using both wild-type and dystrophin-deficient MDX mice, the hypothesis that the deleterious effect of Dp71tg involves an increased fragility of the sarcolemma due to the competition of Dp71 with endogenous full-length Dp427, in the case of wild-type transgenic animals, and upregulated utrophin (6), in the case of mdx transgenic animals. We measured the generation of isometric (Iso) tension before, during, and after a series of forced lengthening contractions and subsequently tested the same muscles for membrane ruptures by using the influx of an indicator dye. We find influences of Dp71tg both on sarcolemmal stability and on Iso tension depending on whether dystrophin is present or absent.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Mutant and control mice. Transgenic MDX mice, generated as previously described (7), were back-crossed on C57BL10 wild-type background. To obtain all genetic combinations in the offspring, heterozygous mdx female mice were mated with hemizygous mdx male mice carrying the skeletal {alpha}-actin promotor transgene (aDp71tg). A second strain carrying a different Dp71tg [CMV promotor Dp71tg (cDp71tg)] was generated on wild-type CB6 (Balb/c x C57BL/6) background (cf. Ref. 10). The cDp71 construct also contains an influenza virus hemagglutinin tag. The hemagglutinin moiety does not seem to contribute to the pathogenicity of the transgene product (10). The breeding and cervical dislocation of mutant and transgenic mice was performed according to German law for the protection of animals with a permit from the local authorities.

Transgenic mice were mated with nontransgenic partners to maintain heterozygozity of the transgene or with transgenic partners to generate homozygous transgenic offspring. In the latter case, transgenic male mice were test mated with two wild-type female mice, and the offspring (15-20 individuals) was analyzed by polymerase chain reaction (PCR). Male mice that produced exclusively transgenic offspring were considered homozygous for the transgene.

Assessment of genotypes. The mdx allele was identified by PCR (1). The following primers (5' -> 3') were used: wild type/mdx, sense, AACTCATCAAATATGCGTGTTAGTG; mdx, antisense, GTCACTCAGATAGTTGAAGCCATTTAA; wild type, antisense, GTCACTCAGATAGTTGAAGCCATTTAG. Amplification was performed by using a "touchdown" procedure (annealing temperature decreased during the first 10 cycles from 60 to 58°C) followed by 25 standard PCR cycles with a constant annealing temperature (58°C).

For identification of the Dp71tg, the following primers (5' -> 3') were used: aDp71, sense, GAAGCTCACTCCTCCACTCGTACC; aDp71, antisense, ATCCTCCCTGTTCGTCCCGTATCATA; cDp71, sense, CGAATTCATGAGGGAACAGCTCAAAGGC; cDp71, antisense, CAGTCTAGGAAGAGGGCCGCTTCG. The same touchdown amplification protocol was used for monitoring of aDp71 and cDp71: 10 cycles during which the annealing temperature decreased from 66 to 64°C, followed by 20 standard PCR cycles with a constant annealing temperature of 64°C.

Mechanophysiology and histopathology. Young adult (90-120 days old) transgenic and nontransgenic wild-type and MDX male mice were used for experiments. Mice were killed by cervical dislocation, and the hind legs were cut off the trunk. Extensor digitorum longus (EDL) muscles were dissected in a continuously exchanged synthetic interstitial fluid (Tyrode solution), containing (in mM) 125 NaCl, 23.81 NaHCO3, 5.37 KCl, 1.0 MgCl2, 1.8 CaCl2, and 10.09 glucose, saturated with 95% O2 and 5% CO2, adjusted to pH 7.2-7.4. One tendon of the muscle was attached to a hook in the experimental chamber and the other to the lever arm of a dual-mode servomotor system (300B-LR, Aurora Scientific, Vata Court, Ontario, Canada) via 6-0 surgical silk (ETHICON, D-22851, Norderstedt, Germany), which was tied securely to the proximal and distal tendons. Isometric (Iso) contractions of freshly prepared EDL muscles were recorded at 25 ± 0.5°C. Muscles were directly stimulated via the chamber fluid with constant supramaximal voltage by using a Grass SD-9 (Grass Instrument, Quincy, MA) stimulator. Muscles were carefully stretched to the length at which single twitches showed the highest amplitude [optimal length (Lo)] and then kept at Lo for subsequent measurements.

For evaluation of peak tetanic tension, stimulation was applied for 0.5 s at a rate of 100 pulses/s. To generate high mechanical stress, a series of five pliometric (Plio) contractions, during which muscles were forcibly stretched at a velocity of 0.5 Lo/s through a distance of 10% Lo during the final 200 ms of an Iso tetanus, with a 4-min recovery period between each contraction, was performed (Plio protocol; cf. Ref. 13). Stretching was controlled by a ramp generator connected to the servomotor. The loss of Iso tension was calculated as (P1 - P5)/P1, where P1 and P5 are the Iso tensions of contractions 1 and 5, respectively. The same protocol, without stretching the muscle during the last 200 ms (Iso protocol), was applied to the contralateral muscle, serving as an internal control. Signals were amplified and visualized on a HAMEG 205-3 oscilloscope (HAMEG, D-60528, Frankfurt, Germany). Data were digitalized and stored with a personal computer and evaluated with Sigma Plot (Jandel Scientific, San Rafael, CA) software. Directly after the experiment, muscles were submerged in Tyrode solution containing 0.2% (wt/vol) reactive orange 14 (RO; Sigma Chemical, St. Louis, MO) for 20 min at room temperature or overnight at 4-8°C. The dye RO is excluded from intact myofibers but stains fibers with sarcolemmal ruptures. Subsequently, the tendons were removed, muscle wet weights were determined, and muscles were shock frozen at -193°C in liquefied propane for histological examination. Cross-sectional areas (CSA) were estimated by dividing muscle wet weight by the product of fiber length and 1.06 g/cm, the density of mammalian skeletal muscle, with fiber length = 0.45 Lo (2).

Shock-frozen muscles were cut into 8-µm sections, dehydrated in alcohol, and embedded in Entellan. Fixed cryosections of EDL muscles were used to determine the number of RO-positive fibers, i.e., those with ruptured sarcolemma.

For immunocytochemistry, cryosections of 8-µm thickness were cut from shock frozen muscles. To suppress background staining by endogenous IgG, sections were blocked for 1 h with papain-digested rabbit-anti-mouse IgG (11) and subsequently stained with DYS1 or DYS2 antibodies (Novocastra) against dystrophin's rod and COOH-terminus, respectively.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 DISCLOSURES
 REFERENCES
 
Presence of dystrophin antigens in Dp71 transgenic muscles. In accordance with biochemical evidence (10), we show in this study, by using domain-specific antibodies to dystrophin, that submembraneous dystrophin is decreased by the presence of ectopic Dp71 in muscle, marginally by the low expressed aDp71tg and drastically by the highly expressed cDp71 (Fig. 1). The deficit in full-length dystrophin seems to be compensated by submembraneous Dp71, which links to the dystroglycan complex but does not connect to the actin cytoskeleton (cf. Ref. 10).



View larger version (151K):
[in this window]
[in a new window]
  		Fig. 1. Immunohistochemical staining with domain-specific anti-dystrophins of gastrocnemius muscles from wild-type (WT), transgenic [WT {alpha}-actin promoter Dp71 (aDp71), WT CMV promoter Dp71 (cDp71)], and dystrophindeficient (mdx) mice. Staining of frozen sections was with antibodies DYS1, specific for dystrophin rod domain (positive for full-length dystrophin), and DYS2, specific for the COOH-terminal region (positive for full-length dystrophin and Dp71). MDX muscle is negative for both antibodies except for 2 somatic revertant fibers in DYS2-stained section (arrow), which serve as internal controls. Membrane-bound dystrophin is suppressed by the ectopic expression of Dp71, marginally with the lowly expressed aDp71 transgene, and drastically with the highly expressed cDp71. Densitometric traces below the panels indicate fluorescence intensities (highest at cell peripheries) along scanning tracks (starting points indicated by triangles).

 

Contractile properties of Dp71 transgenic muscle. The mechanophysiological analyses were performed on isolated EDL muscles from 90- to 120-day-old mice. In the case of mdx mice, the muscle fibers at that age have undergone at least one round of degeneration and regeneration (as witnessed by central nuclei).

Two transgenes, aDp71tg and cDp71tg, of which the latter is expressed earlier and at higher levels, were tested on two wild-type backgrounds, the inbred strain C57BL/10 (BL10), and the hybrid strain C57BL/6 x Balb/c (CB6). Characteristics of twitch and tetanic force generation were very similar between these two mouse strains (Table 1). There was no statistically significant effect of Dp71tg expression (either aDp71tg or cDp71tg) on twitch and tetanic Iso force generation by wild-type EDL muscles. However, the variability of the maximum Iso force values was higher with both transgenes (Fig. 2); time to peak and half-relaxation times were unaffected (Table 1).


View this table:
[in this window]
[in a new window]
  		Table 1. Contractile properties of isolated EDL muscles

 


View larger version (17K):
[in this window]
[in a new window]
  		Fig. 2. Loss of tension during pliometric stress plotted against specific isometric tension of extensor digitorum longus (EDL) muscles. Muscles were stimulated at 100 pulses/s for 0.5 s and forcibly stretched by 10% optimal length (Lo) on the tetanic plateau [pliometric contraction (Plio)] at a velocity of 0.5 Lo/s. Along the abscissa, specific tension (P0) before forced lengthening (Plio) is given. Along the ordinate, the relative irreversible loss of tension due to pliometric stress is indicated. Muscles with compromised dystrophin function experience a higher loss of tension despite lower initial force. Values are means ± SE. Correlation coefficient r is based on 44 single data points.

 

To measure the susceptibility of isolated EDL muscles to mechanical injury, we have applied series of Plio contractions (the muscle is forcibly stretched on the plateau of an Iso tetanic contraction). Maximum tension (Pm) during the imposed stretch (0.5 Lo/s, 10% Lo) was higher by a factor of 1.6-1.8 than the corresponding Iso tension (maximum Iso force) before stretch. With wild-type muscle, aDp71tg had no significant effect on the loss of Iso tension during Plio contractions, but the expression of cDp71tg more than doubled the irreversible reduction of maximum Iso force (Table 1; Fig. 2), indicating a significant weakening of the sarcolemma.

MDX muscle compared with wild-type muscle showed the well-known hypertrophy and deficiencies in specific twitch and tetanic tension (cf. Ref. 3; Table 1). Expression of aDp71tg did not further increase hypertrophy but significantly lowered specific twitch and tetanic tensions (Table 1; Fig. 2). There was again no effect on the time constants of twitches. During Plio contraction, the ratio of the maximum tension during imposed stretch to the corresponding Iso tension was significantly (P < 0.05) higher in MDX aDp71tg but not in MDX EDL muscles compared with wild-type controls. The reason is probably increased stiffness due to secondary fibrosis (connective tissue replacing muscle fibers) in the Dp71 transgenic mice. Unexpectedly, loss of tension on Plio contraction was not increased by aDp71tg expression in MDX muscle. Expression of cDp71tg in MDX mice gave results similar to those with aDp71tg but with higher variability (not shown).

Sarcolemmal damage in Dp71 transgenic muscle. Acute stress-induced sarcolemmal ruptures, as indicated by the influx of RO, have been evaluated on cross sections of EDL muscles, which had previously undergone Plio or, as a control, Iso contractions (Fig. 3). After Iso contraction, there were only very few RO-positive fibers in EDL muscles of all genotypes. In wild-type and wild-type aDp71tg muscles that had undergone Plio contraction, a few RO-positive fibers (<5%) were detected, whereas a large fraction of RO-positive fibers (5-20%) was detected on cross sections of MDX (Fig. 3) and MDX aDp71tg EDL muscles (Figs. 3 and 4). In accordance with the loss of force, an increased number of RO-positive fibers was observed in wild-type cDp71tg (Figs. 3 and 4). No RO-positive fibers were found in contralateral muscles subjected to Iso contraction (not shown); thus the observed damage is not a preparation artifact but is caused by the forced lengthening contractions during Plio contraction. There was a positive correlation of Plio-induced membrane ruptures with loss of tension, with small effects of aDp71tg and strong effects of cDp71tg; the latter, however, were lower than those of dystrophin deficiency (Fig. 4). Intracellular IgG, which is absent from intact fibers, indicates previous transient ruptures of the sarcolemma (cf. Ref. 8). Groups of IgG positive fibers, a characteristic of MDX skeletal muscle, were observed in MDX aDp71tg and in wild-type cDp71tg muscles (not shown).



View larger version (72K):
[in this window]
[in a new window]
  		Fig. 3. Sarcolemmal ruptures after pliometric stress. EDL muscles subjected to the Plio protocol were soaked in physiological solution containing 0.2% (wt/vol) of the fluorescent dye reactive orange (RO). RO-positive (light) fibers (examples, arrows) indicate ruptured sarcolemma. Staining around muscle borders is artifactual, as is the dye binding by tendon (asterisk).

 


View larger version (15K):
[in this window]
[in a new window]
  		Fig. 4. Fraction of damaged fibers related to the loss of tension during pliometric stress. Proportions of dye positive fibers were evaluated on cross sections through the central region of the EDL muscle and plotted against the loss of tension in the same muscle measured after Plio. Data as shown in Fig. 2 (ordinate values) were combined with a quantitative evaluation of histological data as shown in Fig. 3. There is a positive correlation between loss of tension and fraction of muscle fibers with ruptured sarcolemma (RO positive in Fig. 3). Values are means ± SE. Correlation coefficient r is based on 19 data points.

 


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
DISCLOSURES
 REFERENCES
 
According to a traditional view, cytoskeletal proteins serve mainly structural functions, i.e., they would participate in the assembly of elements of cell architecture and serve functions as building blocks, like actin, or as molecular rulers like nebulin and titin (19), or mechanically stabilize the cell, like intermediate filaments and spectrin. However, with a more detailed analysis of the domain structures, especially of larger cytoskeletal proteins, additional roles in intracellular signaling were found (16, 17). Chronic deficits in intracellular signaling pathways may contribute to muscular dystrophy, as do repeated sarcolemmal ruptures caused by mechanical stress.

For the distinction between these two causes of muscle fiber degeneration, mechanophysiological measurements on directly stimulated isolated muscles are informative. Although the previous in situ history of an isolated muscle from a mutant or genetically manipulated organism cannot be entirely eliminated, the immediate effect of mechanical stress can be observed compared with nonstressed mutant and stressed wild-type muscle. In contrast to whole animal experiments, acute humoral, neural, and cardiovascular effects are largely excluded. We have applied this rationale to analyze the effects on muscle of ectopically expressed Dp71. In a parallel investigation, this COOH-terminal gene product of the Dmd gene was shown to exert deleterious, long-term effects on wild-type muscle (10).

Wild-type aDp71 mice display a mild dystrophic phenotype, as indicated by slightly increased numbers of centrally nucleated fibers (10). In our mechanophysiological experiments, we found no effect of either dystrophin deficiency or Dp71tg on the time characteristics of twitch contractions, which in the case of EDL are dominated by fast type II fibers. This is in line with the fact that the fiber-type spectrum and myosin heavy chain composition of adult mdx muscle are very close to those of wild-type muscle (O. Agbulut, G. Butler-Browne, and H. Jockusch, unpublished observations) whereas the low-level-expressed aDp71tg had no effect on the acute stability of wild-type EDL myofibers during Plio contractions. However, although force generation was only marginally affected, the higher levels of cDp71tg significantly increased the susceptibility toward contractile stress, as indicated by an accelerated loss of tension during Plio and by increased numbers of RO-positive fibers.

In addition to the effect on wild-type mice, we found an aggravating rather than ameliorating effect of ectopic Dp71 on dystrophin-deficient MDX muscle. Specific Iso strength, both of twitches and during tetanic contractions, in MDX aDp71tg EDL muscles was reduced by >20% compared with that of nontransgenic MDX controls, and similar, but rather variable, effects were found with high level expressed cDp71tg in MDX muscle (data not shown). Apart from a higher variability in its physiological characteristics, mutant muscle often acquires long-term changes that counteract the acute deleterious effects due to stress. Examples are double mutant myotonic MDX muscles, which "escape" stress damage by shifting to a more resistant fiber type (8), and fibrotic muscles in Dp71 transgenic MDX animals, which, due to their lowered force and increased stiffness, were less susceptible to stress-induced membrane damage than those with a near-normal appearance and force generation. Dp71 transgenic MDX muscles with the best basic performance thus yielded the most clear-cut signals on acute stress-induced damage.

In a previous report (10), our laboratory demonstrated that the levels of utrophin are reduced in muscles of Dp71tg wild-type muscles; in Dp71tg MDX mice, the upregulation observed in standard MDX muscles was partially reversed. In view of the severe pathology of MDX-utrophin-knockout double mutant mice (6), one might speculate that the impaired stability of Dp71 transgenic MDX muscle is caused by an interference with strategically localized utrophin. A molecular model for such dominant negative effects of Dp71, with a binding site only for the dystroglycan complex but not for the microfilament system, has been proposed (10).

Our findings support the view that muscular dystrophies (Duchenne muscular dystrophy and MDX) are predominantly caused by the loss of mechanical protection of muscle fibers in the absence of dystrophin or by its function being compromised by a competing but functionally insufficient protein. Furthermore, our findings provide an explanation of why the expression of Dp71 is specifically repressed in mature skeletal muscle (9).


   DISCLOSURES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
REFERENCES
 
This work was supported by the German Israeli Foundation I-0507-185.03/96, the European Community BIO4-CT98-0547 (Bielefeld), MDA and AFM (Rehovot), and by Fonds der Chemischen Industrie (Bielefeld). U. Nudel is the incumbent of the Elias Sourasky Professorial Chair.


   FOOTNOTES
 

Address for reprint requests and other correspondence: H. Jockusch, Developmental Biology & Molecular Pathology, Univ. of Bielefeld, W7, D-33501 Bielefeld, Germany (E-mail: h.jockusch{at}uni-bielefeld.de).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 

  1. Amalfitano A and Chamberlain JS. The mdx-amplification-resistant mutation system assay, a simple and rapid polymerase chain reaction-based detection of the mdx allele. Muscle Nerve 19: 1549-1553, 1996.[Web of Science][Medline]
  2. Brooks SV. Rapid recovery following contraction-induced injury to in situ skeletal muscles in mdx mice. J Muscle Res Cell Motil 19: 179-187, 1998.[Web of Science][Medline]
  3. Coulton GR, Curtin NA, Morgan JE, and Partridge TA. The mdx mouse skeletal muscle myopathy: II. Contractile properties. Neuropathol Appl Neurobiol 14: 299-314, 1988.[Web of Science][Medline]
  4. Cox GA, Sunada Y, Campbell KP, and Chamberlain JS. Dp71 can restore the dystrophin-associated glycoprotein complex in muscle but fails to prevent dystrophy. Nat Genet 8: 333-339, 1994.[Web of Science][Medline]
  5. Culligan KG, Mackey AJ, Finn DM, Maguire PB, and Ohlendieck K. Role of dystrophin isoforms and associated proteins in muscular dystrophy (review). Int J Mol Med 2: 639-648, 1998.[Web of Science][Medline]
  6. Deconinck AE, Rafael JA, Skinner JA, Brown SC, Potter AC, Metzinger L, Watt DJ, Dickson JG, Tinsley JM, and Davies KE. Utrophin-dystrophin-deficient mice as a model for Duchenne muscular dystrophy. Cell 90: 717-727, 1997.[Web of Science][Medline]
  7. Greenberg DS, Sunada Y, Campbell KP, Yaffe D, and Nudel U. Exogenous Dp71 restores the levels of dystrophin associated proteins but does not alleviate muscle damage in mdx mice. Nat Genet 8: 340-344, 1994.[Web of Science][Medline]
  8. Heimann P, Augustin M, Wieneke S, Heising S, and Jockusch H. Mutual interference of myotonia and muscular dystrophy in the mouse: a study on ADR-mdx double mutants. Neuromuscul Disord 8: 551-560, 1998.[Web of Science][Medline]
  9. Lederfein D, Levy Z, Augier N, Mornet D, Morris G, Fuchs O, Yaffe D, and Nudel U. A 71-kilodalton protein is a major product of the Duchenne muscular dystrophy gene in brain and other non-muscle tissues. Proc Natl Acad Sci USA 89: 5346-5350, 1992.[Abstract/Free Full Text]
  10. Leibovitz S, Meshorer A, Fridman Y, Wieneke S, Jockusch H, Yaffe D, and Nudel U. Exogenous Dp71 is a dominant negative competitor of dystrophin in skeletal muscle. Neuromuscul Disord 12: 836-844, 2002.[Web of Science][Medline]
  11. Lu QL and Partridge TA. A new blocking method for application of murine monoclonal antibody to mouse tissue sections. J Histochem Cytochem 46: 977-984, 1998.[Abstract/Free Full Text]
  12. Marquez FG, Cisneros B, Garcia F, Ceja V, Velazquez F, Depardon F, Cervantes L, Rendon A, Mornet D, Rosas-Vargas H, Mustre M, and Montanez C. Differential expression and subcellular distribution of dystrophin Dp71 isoforms during differentiation process. Neuroscience 118: 957-966, 2003.[Web of Science][Medline]
  13. Menke A and Jockusch H. Decreased osmotic stability of dystrophin-less muscle cells from the mdx mouse. Nature 349: 69-71, 1991.[Medline]
  14. Ohlendieck K. Towards an understanding of the dystrophinglycoprotein complex: linkage between the extracellular matrix and the membrane cytoskeleton in muscle fibers. Eur J Cell Biol 69: 1-10, 1996.[Web of Science][Medline]
  15. Petrof BJ, Shrager JB, Stedman HH, Kelly AM, and Sweeney HL. Dystrophin protects the sarcolemma from stresses developed during muscle contraction. Proc Natl Acad Sci USA 90: 3710-3714, 1993.[Abstract/Free Full Text]
  16. Rafael JA, Townsend ER, Squire SE, Potter AC, Chamberlain JS, and Davies KE. Dystrophin and utrophin influence fiber type composition and post-synaptic membrane structure. Hum Mol Genet 9: 1357-1367, 2000.[Abstract/Free Full Text]
  17. Sorimachi H, Ono Y, and Suzuki K. Skeletal muscle-specific calpain, p94, and connectin/titin: their physiological functions and relationship to limb-girdle muscular dystrophy type 2A. Adv Exp Med Biol 481: 383-395, discussion 395-387, 2000.[Web of Science][Medline]
  18. Tinsley J, Deconinck N, Fisher R, Kahn D, Phelps S, Gillis JM, and Davies K. Expression of full-length utrophin prevents muscular dystrophy in mdx mice. Nat Med 4: 1441-1444, 1998.[Web of Science][Medline]
  19. Van der Ven PF, Bartsch JW, Gautel M, Jockusch H, and Fürst DO. A functional knock-out of titin results in defective myofibril assembly. J Cell Sci 113: 1405-1414, 2000.[Abstract]
  20. Wieneke S, Stehle R, Li Z, and Jockusch H. Generation of tension by skinned fibers and intact skeletal muscles from desmin-deficient mice. Biochem Biophys Res Commun 278: 419-425, 2000.[Web of Science][Medline]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Cell Physiol.Home page
E. R. Barton
Impact of sarcoglycan complex on mechanical signal transduction in murine skeletal muscle
Am J Physiol Cell Physiol, February 1, 2006; 290(2): C411 - C419.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wieneke, S.
Right arrow Articles by Jockusch, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wieneke, S.
Right arrow Articles by Jockusch, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.