|
|
||||||||
1 Institute of Exercise and Sport Sciences and 4 August Krogh Institute, Copenhagen Muscle Research Centre, University of Copenhagen, DK-2100 Copenhagen, Denmark; 2 Wellcome Trust Biocentre, Division of Molecular Physiology, University of Dundee, Dundee DD1 4HN, Scotland, United Kingdom; and 3 Joslin Diabetes Center, Harvard Medical School, Boston, Massachusetts 02215
| |
ABSTRACT |
|---|
|
|
|---|
5'-AMP-activated
protein kinase (AMPK) has been proposed to be a pivotal factor in
cellular responses to both acute exercise and exercise
training. To investigate whether protein levels and gene
expression of catalytic (
1,
2) and
regulatory (
1,
2,
1,
2,
3) AMPK subunits and exercise-induced
AMPK activity are influenced by exercise training status, muscle
biopsies were obtained from seven endurance exercise-trained and seven
sedentary young healthy men. The
1- and
2-AMPK mRNA contents in trained subjects were both
117 ± 2% of that in sedentary subjects (not significant), whereas mRNA for
3 was 61 ± 1% of that in
sedentary subjects (not significant). The level of
1-AMPK protein in trained subjects was 185 ± 34%
of that in sedentary subjects (P < 0.05), whereas the
levels of the remaining subunits (
2,
1,
2,
1,
2,
3) were similar in trained and sedentary subjects. At the end of 20 min of
cycle exercise at 80% of peak O2 uptake, the increase in
phosphorylation of
-AMPK (Thr172) was blunted in the
trained group (138 ± 38% above rest) compared with the sedentary
group (353 ± 63% above rest) (P < 0.05). Acetyl CoA-carboxylase
-phosphorylation (Ser221), which is a
marker for in vivo AMPK activity, was increased by exercise in both
groups but to a lower level in trained subjects (32 ± 5 arbitrary
units) than in sedentary controls (45 ± 1 arbitrary units)
(P < 0.01). In conclusion, trained human skeletal
muscle has increased
1-AMPK protein levels and blunted
AMPK activation during exercise.
acetyl coenzyme A-carboxylase-
; phosphocreatine; adenine
nucleotides; glycogen
| |
INTRODUCTION |
|---|
|
|
|---|
5'-AMP-ACTIVATED PROTEIN KINASE (AMPK) is a ubiquitously expressed sensor of cellular energy charge. On activation, AMPK switches off ATP-consuming anabolic processes and turns on ATP-producing catabolic processes via phosphorylation of several downstream metabolic enzymes and via effects on gene expression (recently reviewed by Ref. 21). AMPK is activated by acute exercise in human skeletal muscle (6, 19, 35, 44, 49, 57), and several studies propose a regulatory role for AMPK in exercise-induced fatty acid oxidation (reviewed by Refs. 53, 54) and glucose metabolism (reviewed by Refs. 20, 43).
Repeated bouts of acute exercise over a prolonged period of time
(exercise training) induce health-beneficial adaptations in several
body tissues (4). Many of the adaptations taking place in
skeletal muscle in response to exercise training are proposed to
involve AMPK. This is based on the observations that chronic
pharmacological activation of AMPK, like exercise training, both
enhances the gene expression of the glucose transporter GLUT-4, hexokinase, citrate synthase, and cytochrome c and increases
mitochondrial density and muscle glycogen content in rodent skeletal
muscle (3, 5, 25, 55, 61). Furthermore, chronic activation of AMPK by
5-aminoimidazole-4-carboxamide-1-
-D-ribofuranoside (AICAR) increases insulin-induced glucose utilization in rodent skeletal muscle (5, 15) similar to exercise training
(10, 11, 38). However, AICAR may be somewhat nonspecific
in activating AMPK (2), and, therefore, these findings
should be interpreted carefully. Supporting the direct role of AMPK in
these adaptations is a study in which a constitutively active AMPK
mutant is expressed in the H-2Kb skeletal muscle cell line.
These experiments show that increased AMPK activity is sufficient to
increase GLUT-4 and hexokinase protein levels (18) and
suggest a key role for AMPK activity in the metabolic adaptations to
exercise training.
AMPK is a heterotrimer consisting of three subunits designated as
,
, and
. In mammalian cells, two isoforms of the
-subunit, which contains the catalytic domain, have been identified
(
1 and
2). The
(
1 and
2 isoforms) and the
(
1,
2, and
3 isoforms) regulatory subunits
are needed in complex with the
-subunit for full kinase activity
(14, 59). The
1-isoform is widely distributed in different body tissues, whereas
2 is
primarily expressed in skeletal muscle, heart, and liver
(47). In INS-1 cells and skeletal muscle tissue,
1 is mainly found in the cytosol, whereas
2 is localized both in cytosol and nuclei (1,
45). Interestingly, of the two
-subunits identified, the
2-protein is abundantly expressed in skeletal muscle
compared with
1 (50). AMPK
1- and
2-mRNA are found in a variety
of tissues, whereas significant expression of
3-mRNA was detected in skeletal muscle only, although
the protein appeared to be much more widely expressed (7).
Regulation of AMPK activity involves several mechanisms. Allosteric
activation of AMPK is brought about by an increase in the AMP-to-ATP
ratio (AMP/ATP) and a decrease in the phosphocreatine-to-creatine ratio
(PCr/Cr) (41). Furthermore, AMPK is covalently activated by kinases (AMPKKs) via phosphorylation on Thr172 of the
-subunit (23, 48). AMPKK, like AMPK, is also
allosterically activated by AMP (24, 48) but appears not
to be regulated by PCr. Binding of AMP to AMPK makes the enzyme a
better substrate for AMPKK (23) and a worse substrate for
deactivating protein phosphatases (9). Altogether, these
mechanisms would ensure that the AMPK system responds to changes in
cellular AMP in an ultrasensitive manner (22). Recent
studies suggest a role for glycogen in the regulation of AMPK activity.
In rodent skeletal muscle, high muscle glycogen levels, induced by
exercise training or a combination of prior exercise and diet, are
associated with low-basal and exercise- or AICAR-stimulated
2-AMPK activity, compared with skeletal muscle with
normal or low-glycogen levels (12, 28, 56). Importantly,
this effect of glycogen is possibly independent of changes in adenine
nucleotide concentrations (56).
Taken together, there is evidence to suggest that AMPK may mediate many
of the effects of acute exercise and exercise training on skeletal
muscle substrate metabolism and gene expression. Recently, a study
investigated AMPK activity and AMPK subunit protein levels in trained
and untrained rat skeletal muscle after exercise at the same absolute
workload and observed a blunted exercise-induced AMPK activity and an
increased protein level of the
3-subunit in the red
quadriceps muscle of the trained animals (13). In human
skeletal muscle, the regulation of AMPK has been studied by using
different exercise intensities (57), but the effect of
training status on exercise-induced AMPK activity has so far not been
elucidated in humans. Given the possible role of AMPK in
exercise-induced gene expression, we hypothesized that exercise training regulates the gene expression and protein levels of AMPK in
human skeletal muscle. In the present study, regulation of AMPK in
human skeletal muscle from exercise-trained and sedentary subjects was
studied at rest and during exercise at the same relative workload.
Furthermore, gene expression and protein levels of the various AMPK
subunit isoforms were determined.
| |
METHODS |
|---|
|
|
|---|
Subjects.
Fourteen young healthy men (7 exercise-trained and 7 sedentary
subjects) gave their informed consent to participate in the study. The
exercise-trained subjects participated in physical exercise training
(long-distance running, bicycle road racing, and indoor cycle spinning)
four to eight times per week, whereas the sedentary control subjects
did not participate in any regular physical activity. One to two weeks
before the experiment, peak O2 consumption
(
O2 peak) was determined during an
incremental cycle ergometer test. The
O2 peak was >59 and <46 ml O2 · min
1 · kg
1
for the trained and sedentary subjects, respectively.
Experimental protocol.
The day before the experiment, the subjects abstained from exercise and
ate a mixed diet (57% carbohydrates, 27% fat, 16% protein). On the
day of the experiment, the subjects arrived in the laboratory in the
morning after a 10-h overnight fast. A catheter was inserted in the
antecubital vein of the forearm for blood sampling. The subjects
exercised for 20 min on a cycle ergometer (Monark) at the same relative
workload (80% of
O2 peak). Pulmonary
oxygen and carbon dioxide exchange was measured by using an on-line gas
and airflow analyzer (Medgraphics, Medical Graphics). Glucose and fat
oxidation were evaluated by indirect calorimetry according to Frayn
(17), with the exception that measurements were not
corrected for urinary nitrogen. Needle biopsies from vastus lateralis
muscle and blood samples were obtained at rest and at the end of
exercise under local anesthesia by using Xylocain (Lidocain). The
Copenhagen Ethics Committee approved the experimental protocol, and all
human experiments conformed to the Declaration of Helsinki.
Analysis of blood and plasma substrates and hormones. Glucose and lactate concentrations in blood were determined in duplicate by using a dual-channel glucose-lactate analyzer (YSI-2700 Select; Yellow Springs Instruments, Yellow Springs, OH). Plasma insulin concentration was determined by using a radioimmunoassay kit (Insulin Ria 100, Pharmacia). Concentrations of plasma long-chain fatty acids (LCFA) were determined in accordance with Shimizu et al. (46) by using an automatic spectrophotometer (COBAS FARA 2, Roche Diagnostic). Plasma epinephrine and norepinephrine were analyzed by means of a radioimmunoassay (KatCombi, Immuno-Biological Laboratories, Hamburg, Germany).
Muscle lactate, adenosine nucleotides, Cr, and PCr.
Freeze-dried muscle biopsy specimens were extracted with perchloric
acid, neutralized, and analyzed for lactate and adenosine nucleotides.
Contents of ATP, ADP, AMP, and IMP were determined by reverse-phase
HPLC, according to a previously described method (52).
Muscle lactate, Cr, and PCr content were measured fluorometrically, as
described previously (37). The estimation of free
concentrations of ADP and AMP was based on the near-equilibrium nature
of the Cr phosphokinase and adenylate kinase reactions, respectively. Free ADP was estimated from the measured ATP, Cr, and PCr contents, and
the H+ concentration was estimated by using the measured
muscle lactate content, according to the formula for dry muscle
presented by Mannion et al. (33). The equilibrium constant
value employed for Cr phosphokinase was 1.66 × 109
M
1 (29). Free AMP (AMPfree) was
estimated from the measured ATP and the estimated free ADP by using an
observed equilibrium constant for adenylate kinase of 1.05 (29).
Muscle glycogen. Muscle glycogen concentration in freeze-dried muscle tissue was measured by fluorometry as glycosyl units after acid hydrolysis, as previously described (37).
Muscle lysate preparation. For studies of enzyme activity and phosphorylation, ~40 mg of frozen muscle tissue were homogenized, as described previously (34). Homogenates were rotated end over end at 4°C for 60 min, after which they were centrifuged at 4°C for 30 min at 4,000 g. The supernatants were harvested, and total protein content was determined in the lysates by the bicinchoninic acid method (Pierce). For measurement of protein levels of the AMPK subunit isoforms, muscle lysates were prepared, as described previously (13).
AMPK activity.
-Isoform-specific AMPK activity was measured in immunoprecipitates
from 100 µg of muscle lysate protein by using an
anti-
1-AMPK and an anti-
2-AMPK antibody.
A p81 filter paper assay, with the use of SAMS-peptide (200 µM) as
the substrate, was used to measure AMPK activity in the presence of a
saturating concentration of AMP (0.2 mM), as previously described
(57).
AMPK and acetyl CoA-carboxylase-
phosphorylation.
The phosphorylation of the
-subunits (Thr172) and acetyl
CoA-carboxylase (ACC)-
(Ser221) was evaluated by Western
blotting by using phospho-specific antibodies from Cell Signaling
Technology and Upstate Biotechnology, respectively. The ACC
phospho-specific antibody is raised against a peptide corresponding to
the sequence in rat ACC-
containing the Ser79
phosphorylation site, but the antibody also recognized the human ACC-
when phosphorylated, most likely at the corresponding
Ser221. For the detection of
-AMPK phosphorylation
(Thr172), 45 µg of muscle lysate protein were subjected
to SDS-PAGE (4-15% gradient gel) and Western blotting. ACC-
was affinity purified from 300-µg muscle lysate protein and subjected
to SDS-PAGE (4-15% gradient gel), as described previously
(6). Immunoreactive bands were visualized with enhanced
chemiluminescense (ECL+, Amersham Pharmacia Biotech) and detected and
quantified with the use of a coupled device image sensor and 1D
software (Image Station, E440CF, Kodak).
AMPK subunit mRNA.
For the determination of mRNA content, isolation of total RNA, RT, and
PCR were carried out as follows. Total RNA was isolated from ~25 mg
of tissue by a modified guanidinium thiocyanate-phenol-chloroform extraction method adapted from Chomczynski and Sacchi (8)
and as described previously (40). RNA was resuspended
overnight (4°C) in 2 µl/mg original tissue weight in diethyl
pyrocarbonate-treated H2O containing 0.1 mM EDTA. RT of 22 µl of total RNA sample was performed by using the Superscript II
RNase H
system (GIBCO-BRL), as previously described
(40). RT products were diluted in nuclease-free
H2O to a total volume of 300 µl. The mRNA content of the
selected genes was determined by fluorescence-based real-time PCR (ABI
PRISM 7700 Sequence Detection System, Applied Biosystems). Forward (FP)
and reverse primers (RP) and TaqMan probes were designed from
human-specific sequence data (Entrez-NIH and Ensemble, Sanger
Institute) by using computer software (Primer Express, Applied
Biosystems). The following sequences were used to amplify a fragment of
AMPK-
1 FP: 5' CAGGGACTGCTACTCCACAGAGA 3'; RP: 5'
CCTTGAGCCTCAGCATCTGAA 3'; probe: 5'
TCAGTTAGCAACTATCGATCTTGCCAAAGGAGT 3'; and of
AMPK-
2 FP: 5' CAACTGCAGAGAGCCATTCACTT 3'; RP: 5'
GGTGAAACTGAAGACAATGTGCTT 3'; probe: 5' CTGGCTCTCTCACTGGCTCTTTGACCG 3';
and of AMPK-
3 FP: 5' GGAAGTGATCGACAGGATTGC 3'; RP: 5'
GAGATGCTGGGTCTCGTCCA 3'; probe: 5' CGGGAGCAGGTACACAGGCTGGTG 3'. The
probes were 5'6-caboxyfluorescein (FAM) and
3'6-carboxy-N,N,N',N'-tetramethylrhodamine
(TAMRA) labeled. Prior optimization was conducted for each set of
self-designed oligos determining optimal primer concentrations and
probe concentration and verifying the efficiency of the amplification.
For each of the target genes, the expected size of the PCR product was
confirmed on a DNA 2.5% agarose gel. GAPDH was also amplified for use
as endogenous control by using a predeveloped assay reaction (Applied Biosystems). PCR amplification was performed (in triplicates) in a
total reaction volume of 25 µl. The reaction mixture consisted of 2.5 µl diluted template, FP and RP, and probe, as determined from the
prior optimization, 2× TaqMan Universal MasterMix optimized for TaqMan
reactions (Applied Biosystems; containing AmpliTaq Gold DNA polymerase,
AmpErase Uracil N-glycosylase, dNTPs with dUTP, ROX as
passive reference, and buffer components), and nuclease-free water. The
following cycle profile was used for all genes: 50°C for 2 min + 95°C for 10 min + [95°C for 15 s + 60°C for 1 min] × 40 cycles.
AMPK subunit protein levels.
Western blotting for the AMPK subunit isoforms was performed as
described previously (13), except in the case of
1. In the latter case, a "pan"
-antibody was
generated in sheep to the peptide CRAAPLWDSKKQSFVG (residues
69-83 plus NH2-terminal cysteine) of rat
1, a sequence highly conserved in human
2
and
3) coupled to keyhole limpet haemocyanin and
affinity purified as described previously (59).
Statistics. Data are expressed as means ± SE. Two-tailed nonpaired Student's t-tests were applied for comparison of two normally distributed groups. Comparisons between two normally distributed groups before and at the end of exercise were done by two-way ANOVA for repeated measures for the detection of main effects and interactions between the different groups. If interactions between groups were detected, two-way ANOVA for repeated measures was followed by a multiple-comparison test (Student-Newman-Keuls method). Correlations were analyzed by Pearson product-moment correlation analysis for two parameters and with multiple linear regression for three parameters. P < 0.05 was considered statistically significant.
| |
RESULTS |
|---|
|
|
|---|
Subject characteristics.
Age (25 ± 1 vs. 25 ± 1 yr), height (183 ± 3 vs.
186 ± 2 cm), body weight (79 ± 4 vs. 86 ± 3 kg), and
body mass index (24 ± 1 vs. 25 ± 1 kg/m2) were
similar in the exercise-trained and the sedentary subjects, respectively, whereas
O2 peak was
significantly higher in the trained than in the sedentary subjects
(66 ± 2 vs. 44 ± 1 ml
O2 · min
1 · kg
1;
P < 0.05).
Pulmonary and cardiac responses to exercise.
The trained and sedentary subjects exercised at the same relative
workload, eliciting a similar heart rate, respiratory exchange ratio,
and fat oxidation rate determined during the last 2 min of exercise.
The workload, pulmonary oxygen uptake, and carbohydrate oxidation rate
were significantly higher in the trained than in the sedentary subjects
(P < 0.05) (Table 1).
|
Blood and plasma substrates and hormones.
In the resting condition, blood glucose, blood lactate, plasma LCFA,
plasma insulin, plasma epinephrine, and plasma norepinephrine were
similar in trained and sedentary subjects. In response to exercise,
blood lactate and plasma epinephrine increased (P < 0.001) and plasma LCFA and plasma insulin decreased (P < 0.001), but no differences were present between the two groups.
Blood glucose increased in response to exercise in the trained subjects (P < 0.01) to a higher level than in the sedentary
subjects (P < 0.05). Plasma norepinephrine increased
in response to exercise in both groups, but, at the end of exercise,
the concentration was significantly higher in the trained group (Table
2).
|
Muscle lactate, nucleotides, Cr, and PCr.
Muscle lactate was not different between sedentary and trained subjects
at rest, and in both groups muscle lactate increased in response to
exercise. However, at the end of exercise, muscle lactate was
significantly lower in the trained than in the sedentary group (Table
3). No differences in ATP, AMP, IMP, Cr,
or PCr concentrations or AMP/ATP or PCr/(PCr + Cr) were present
between the trained and sedentary group in the resting state, whereas the ADP concentration was lower in the trained group (P < 0.01, main effect). The ADP, IMP, and Cr concentrations increased,
whereas the PCr concentration and PCr/(PCr + Cr) decreased in
response to exercise (P < 0.01). At the end of the
exercise bout, the Cr content was lower and the PCr content and
PCr/(PCr + Cr) were higher (P < 0.05) in the
trained subjects than in the sedentary subjects (Table 3). The
calculated concentration of cytosolic AMP (AMPfree) and
AMPfree/ATP increased in response to acute exercise, and,
although there appeared to be a larger increase in the sedentary group,
this was not significant (Table 3). It should be noted that calculation
of AMPfree involves estimation of the muscle H+
concentration from the measured muscle lactate concentration. As
trained muscle has a higher dynamic buffer capacity for H+,
a given measured lactate accumulation will be followed by a smaller
increase in H+ in trained than in sedentary muscle. This
may lead to an underestimation of AMPfree in the trained
group.
|
Muscle glycogen.
In the resting state, the muscle glycogen content was higher in the
trained than in the sedentary group (P < 0.05), and
glycogen content decreased during exercise to a similar level in the
two groups (P < 0.01) (Fig.
1). However, the decrease in glycogen content was not significantly different between the trained and sedentary subjects.
|
The
1- and
2-AMPK activities.
The resting activities of
1- and
2-AMPK were not different between trained and sedentary
subjects. The
2-AMPK activity was significantly higher
at the end of exercise (P < 0.01, main effect),
although no significant difference was present between the trained and
sedentary subjects (P = 0.24) (Fig.
2B). The increase in
2-AMPK activity above resting level was 110 ± 33 and 184 ± 31% in trained and sedentary subjects, respectively,
but these increases were not significantly different (P = 0.21).
|
-AMPK phosphorylation (Thr172).
In concordance with
-AMPK activity,
-AMPK phosphorylation at
Thr172 on the
-subunit was not different between the two
groups of subjects at rest. In response to exercise,
-AMPK
phosphorylation increased significantly (P < 0.01, main effect), and the increase in AMPK phosphorylation above the
resting level was significantly reduced in the trained group compared
with the sedentary group (Fig. 3).
|
ACC-
phosphorylation (Ser221).
At rest, ACC-
phosphorylation (Ser221) was not different
between the trained and sedentary subjects. During exercise, ACC-
phosphorylation was significantly increased in both groups
(P < 0.001), but ACC-
phosphorylation was
significantly lower in the trained than in the sedentary subjects
(P < 0.01), and the increase in ACC-
phosphorylation above the resting level tended (P = 0.071) to be lower in the trained group than in the sedentary group
(Fig. 4).
|
AMPK subunit mRNA expression.
The
1-,
2-, and
3-subunits
were chosen for mRNA expression analyses as the levels of these protein
subunits have previously been shown to change in response to
physiological perturbations in rodents (13, 51). The mRNA
content of the
1- and
2-subunits of AMPK
was not different between trained and sedentary subjects, but the level
of
3-mRNA tended to be lower (P = 0.078)
in the trained group than in the sedentary group (Fig.
5).
|
AMPK subunit protein levels.
The protein content of the AMPK
1-subunit in trained
muscle was 185% of that in sedentary muscle (P < 0.05) (Fig. 6). The
2-protein level in trained subjects was 148% of that in
sedentary subjects (P = 0.06). Protein levels of
2-,
1-,
1-,
2-, and
3-subunits were similar in the
trained and sedentary groups.
|
Correlation analyses.
When the data from the trained and the sedentary groups were
pooled, the exercise-induced decrease in PCr/(PCr + Cr) correlated significantly with measures of exercise-induced changes in
-AMPK activity [
1: r = 0.61, P = 0.02;
2: r = 0.72, P = 0.005;
-AMPK phosphorylation
(Thr172): r = 0.78, P = 0.002; and ACC-
phosphorylation (Ser221):
r = 0.67, P = 0.01] (not shown). The
decrease in glycogen alone did not correlate with any of the obtained
measures of increase in AMPK activity (not shown), probably due to the
limited variability in the amount of glycogen broken down in the
subjects. Nevertheless, the increase in
2-AMPK activity
was tightly correlated with the decrease in PCr/(PCr + Cr) and the
decrease in glycogen when analyzed by multiple linear regression
(r = 0.81, P = 0.005) (Fig.
7). No correlations were present between
AMPfree/ATP (increase or absolute level) and any of the
obtained measures of AMPK activity.
|
| |
DISCUSSION |
|---|
|
|
|---|
In the present study, we investigated mRNA expression and protein
levels of AMPK subunit isoforms and the effect of acute exercise
on AMPK activity in skeletal muscle of trained and sedentary subjects.
In response to acute exercise at 80% of
O2 peak,
2-AMPK
activity,
-AMPK phosphorylation (Thr172), and ACC-
phosphorylation (Ser221) increased, whereas
1-associated activity was unchanged. ACC-
phosphorylation during exercise and the exercise-induced increase in
-AMPK phosphorylation were significantly blunted in the trained group compared with the sedentary group. No significant difference in
skeletal muscle mRNA content for the
1-,
2-, and
3-subunit could be detected
between trained and sedentary subjects. At the protein level, the
1-AMPK was significantly higher in trained subjects than
in sedentary subjects.
In the context of a long-term training regime, it is well known that a continued progressive improvement of exercise performance and training-induced cellular adaptations, such as increased GLUT-4 levels, are dependent on a progressive increase in training amount and intensity (26, 39). The observation that exercise-induced AMPK activity is blunted in trained subjects compared with sedentary subjects working at the same relative intensity might in part explain this phenomenon, considering the possible role of AMPK in exercise-induced gene expression (see below). Despite higher absolute energy requirement in the trained than in the sedentary subjects at the same relative exercise intensity, the energy charge is better maintained in the trained individuals, as reflected by the difference in PCr/(PCr + Cr) between trained and sedentary subjects. Besides providing an explanation for the lower AMPK activation in the trained subjects, it illustrates the important point that AMPK activity is not a marker of total energy flux during exercise, but rather a result of the perturbations in the energy charge induced by exercise.
The blunted exercise-induced in vivo activity of AMPK in the trained
group was reflected by a decreased Ser221 phosphorylation
of its downstream target, ACC-
. In accordance with our findings,
studies in rats have demonstrated a blunted ACC inactivation by
exercise at the same absolute workload after training in red quadriceps
and gastrocnemius muscle (13, 27). Our finding that
ACC-
phosphorylation (Ser221) is reduced in trained
subjects could be explained by an allosteric influence on AMPK of the
low-Cr and high-PCr levels observed in the present study and by others
(42). The improved maintenance of the PCr stores in the
trained subjects during acute exercise is probably related to a higher
capacity of oxidative ATP generation due to increased activity and
expression of enzymes in the oxidative pathways. Furthermore, the
diminished muscle lactate concentration during acute exercise in the
trained subjects indicates a reduced exercise-induced acidification.
This could also help explain the blunted AMPK activation in trained
muscle, because in vitro experiments have demonstrated that a
progressive decrease in pH induces a progressive increase in AMPK
activity (41).
The exercise-induced increase in
-AMPK phosphorylation
(Thr172) was also lower in the trained than in the
sedentary subjects. This indicates that, not only allosteric, but also
covalent regulation of AMPK by phosphorylation was different between
trained and sedentary subjects. This is in accordance with observations
in rat skeletal muscle (13). The regulation of the
upstream kinases (AMPKKs) responsible for Thr172
phosphorylation of the
-subunit of AMPK is not fully elucidated. However, AMPfree is known to activate AMPKK, leading to
phosphorylation and activation of AMPK, but, because of methodological
inadequacies, it is unfortunately not feasible to measure
AMPfree. In the present study, calculated estimates of
AMPfree or AMPfree/ATP could not explain the
difference in AMPK phosphorylation. It should be considered that the
blunted AMPK activation in trained muscle during acute exercise could
be due to enhanced AMPK-directed phosphatase activity in these
subjects, although this remains to be shown. The finding that the
increase in covalently modified AMPK activity correlated with the
decrease in PCr/(PCr + Cr), but not AMPfree or
AMPfree/ATP, is not easily explained. However, it should be
stressed that the latter were calculated estimates and not direct
measures. Probably PCr/(PCr + Cr) is a more accurate measure of
cellular energy charge than calculated AMPfree values. PCr
has been identified as an allosteric regulator of AMPK, but the ability
of PCr to modulate the activity of the upstream AMPKK, or to change the
susceptibility of AMPK to phosphorylation-dephosphorylation, has not
been found (D. G. Hardie, unpublished observations).
It has been observed that high muscle glycogen levels negatively
influence AMPK activity (12, 28, 44, 56). Interestingly, a
fairly tight relationship was observed among an exercise-induced increase in
2-AMPK activity, decrease in PCr/(PCr + Cr), and decrease in glycogen content, indicating that glycogen may act in concert with other factors in the modulation of AMPK activity. Taken
as a whole, concomitant changes in several factors are likely to
contribute to the increased AMPK activity in response to exercise: increased muscle lactate levels leading to acidification, a decrease in
PCr/(PCr + Cr), an increase in AMPfree/ATP, and
possibly decreased glycogen levels. It could be speculated that the
importance of each of these regulator factors varies, depending on the
exercise conditions, i.e., exercise duration, exercise intensity, and
training status.
AMPK is a promising candidate for mediating several of the adaptive
responses in gene expression to exercise training. This is primarily
based on the observation that repeated activation of AMPK by AICAR
treatment and expression of a constitutively active AMPK mutant in
cultured muscle cells mimic many of the changes in protein levels
induced by repeated exercise bouts (3, 5, 18, 25, 55). A
role for AMPK in regulation of gene transcription is supported by the
observations that activation of AMPK regulates expression of several
genes in liver cells (16, 30, 31, 58). Furthermore, it has
been observed that the transcriptional coactivator p300 is a substrate
of AMPK (60) and that AMPK activation by AICAR increases
GLUT-4 transcription in muscle (61) with a time course and
regional promoter sequence requirement similar to that of exercise
(32, 36). Based on the present study, it could be
hypothesized that an increase in
1-AMPK protein content
is involved in these adaptations, although the role of this AMPK
subunit in cellular responses to exercise remains poorly understood. In
rat skeletal muscle, exercise training elicited an increase in
3-protein content in red quadriceps, concomitant with an
increase in GLUT-4 and other exercise-associated increases in protein
levels. Interestingly, there also appeared to be an ~50% increase in
the level of
1, although, along with changes in other
subunit isoforms, this was not statistically significant. No changes in
AMPK subunit protein level in white quadriceps and soleus muscle were
observed. However, this could be related to the fact that these muscles
were recruited to a low extent, judged from the unchanged GLUT-4
concentration in these two muscles (13). It is not clear
at present why the response to training should be different in rats
than in humans, although this might reflect the fact that this is a
cross-sectional study and that the training regimes are not directly
comparable. The finding that chronic alterations in myocardial
energetics in hypertrophied rat hearts (left ventricular hypertrophy)
are associated with a twofold increase in the
1-protein
level and a 30% decrease in the
2-level
(51) supports the idea that
1-AMPK protein levels are positively influenced by long-term perturbations of the
cellular energy charge, e.g., exercise training. In INS-1 cells, it has
been observed that
2 but not
1 is found
in the nuclei, suggesting a role of
2 rather than
1 in gene expression (45). It is noteworthy
that the
1-protein content was elevated in the trained
subjects compared with sedentary subjects, whereas the
1-mRNA level was similar in the trained and sedentary
subjects, indicating that the training-induced changes in the
1-AMPK protein content take place at the
posttranscriptional level. Alternatively, mRNA levels are increased
after each training bout, but the duration of the increase is <1 day,
which was the time the trained subjects abstained from training before
taking part in the study. Finally, it should be mentioned that, because
of the cross-sectional study design, it cannot be excluded that the
difference in
1-AMPK protein is due to genetic
differences rather than to the effect of training per se. A
longitudinal training study would be needed to clarify this. Clearly,
more work is needed to address the role of the specific AMPK isoforms
in skeletal muscle, but it could be hypothesized that skeletal muscle
adaptations to exercise training are dependent in part on changes in
the
1-AMPK subunit level. Thus changes in the
1-AMPK subunit level per se might facilitate the
beneficial training-induced adaptations in skeletal muscle.
In conclusion, activation of AMPK in response to acute exercise
is diminished in skeletal muscle of trained individuals compared with
sedentary subjects working at the same relative intensity. This is
probably due to a better maintenance of the energy charge and a less
pronounced exercise-induced acidification in exercise-trained muscle.
Furthermore, AMPK subunit protein level of
1 was higher in exercise-trained than in sedentary human skeletal muscle, suggesting a role for this subunit in the adaptations to exercise training.
| |
ACKNOWLEDGEMENTS |
|---|
Ylva Hellsten is acknowledged for measurements of adenosine nucleotides. Christian Frøsig, Betina Bolmgren, Karina Olsen, and Winnie Taagerup are acknowledged for excellent technical contributions.
| |
FOOTNOTES |
|---|
This study was supported by a Research and Technological Development Project (QLG1-CT-2001-01488) funded by the European Commission and by Grant 504-14 from the Danish National Research Foundation and the Media and Grants Secretariat of the Danish Ministry of Culture. J. F. P Wojtaszewski was supported by a postdoctoral fellowship from the Danish Medical Research Council. D. G. Hardie was supported by a Programme Grant from the Wellcome Trust (UK) and a Project Grant from Diabetes UK, and K. J. Mustard was supported by a studentship jointly sponsored by the Biotechnology and Biological Sciences Research Council (UK) and Novo-Nordisk.
Address for reprint requests and other correspondence: J. N. Nielsen, Copenhagen Muscle Research Centre, Dept. of Human Physiology, Univ. of Copenhagen, 13 Universitetsparken, DK-2100 Copenhagen, Denmark (E-mail: JNNielsen{at}aki.ku.dk).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published October 11, 2002;10.1152/japplphysiol.00642.2002
Received 15 July 2002; accepted in final form 7 October 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Ai, H,
Ihlemann J,
Hellsten Y,
Lauritzen HPMM,
Hardie DG,
Galbo H,
and
Ploug T.
Effect of fiber type and nutritional state on AICAR- and contraction-stimulated glucose transport in rat muscle.
Am J Physiol Endocrinol Metab
282:
E1291-E1300,
2002
2.
Baggott, JE,
Vaughn WH,
and
Hudson BB.
Inhibition of 5-aminoimidazole-4-carboxamide ribotide transformylase, adenosine deaminase and 5'-adenylate deaminase by polyglutamates of methotrexate and oxidized folates and by 5-aminoimidazole-4-carboxamide riboside and ribotide.
Biochem J
236:
193-200,
1986[Web of Science][Medline].
3.
Bergeron, R,
Ren JM,
Cadman KS,
Moore IK,
Perret P,
Pypaert M,
Young LH,
Semenkovich CF,
and
Shulman GI.
Chronic activation of AMP kinase results in NRF-1 activation and mitochondrial biogenesis.
Am J Physiol Endocrinol Metab
281:
E1340-E1346,
2001
4.
Booth, FW,
Chakravarthy MV,
Gordon SE,
and
Spangenburg EE.
Waging war on physical inactivity: using modern molecular ammunition against an ancient enemy.
J Appl Physiol
93:
3-30,
2002
5.
Buhl, ES,
Jessen N,
Schmitz O,
Pedersen SB,
Pedersen O,
Holman GD,
and
Lund S.
Chronic treatment with 5-aminoimidazole-4-carboxamide-1-
-D-ribofuranoside increases insulin-stimulated glucose uptake and GLUT4 translocation in rat skeletal muscles in a fiber type-specific manner.
Diabetes
50:
12-17,
2001
6.
Chen, ZP,
McConell GK,
Michell BJ,
Snow RJ,
Canny BJ,
and
Kemp BE.
AMPK signaling in contracting human skeletal muscle: acetyl-CoA carboxylase and NO synthase phosphorylation.
Am J Physiol Endocrinol Metab
279:
E1202-E1206,
2000
7.
Cheung, PC,
Salt IP,
Davies SP,
Hardie DG,
and
Carling D.
Characterization of AMP-activated protein kinase gamma-subunit isoforms and their role in AMP binding.
Biochem J
346:
659-669,
2000[Web of Science][Medline].
8.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
9.
Davies, SP,
Helps NR,
Cohen PT,
and
Hardie DG.
5'-AMP inhibits dephosphorylation, as well as promoting phosphorylation, of the AMP-activated protein kinase. Studies using bacterially expressed human protein phosphatase-2C alpha and native bovine protein phosphatase-2AC.
FEBS Lett
377:
421-425,
1995[Web of Science][Medline].
10.
Dela, F,
Larsen JJ,
Mikines KJ,
Ploug T,
Petersen LN,
and
Galbo H.
Insulin-stimulated muscle glucose clearance in patients with NIDDM. Effects of one-legged physical training.
Diabetes
44:
1010-1020,
1995[Abstract].
11.
Dela, F,
Mikines KJ,
Von Linstow M,
Secher NH,
and
Galbo H.
Effect of training on insulin-mediated glucose uptake in human muscle.
Am J Physiol Endocrinol Metab
263:
E1134-E1143,
1992.
12.
Derave, W,
Ai H,
Ihlemann J,
Witters LA,
Kristiansen S,
Richter EA,
and
Ploug T.
Dissociation of AMP-activated protein kinase activation and glucose transport in contracting slow-twitch muscle.
Diabetes
49:
1281-1287,
2000[Abstract].
13.
Durante, PE,
Mustard KJ,
Park SH,
Winder WW,
and
Hardie DG.
Effects of endurance training on activity and expression of AMP-activated protein kinase isoforms in rat muscles.
Am J Physiol Endocrinol Metab
283:
E178-E186,
2002
14.
Dyck, JR,
Gao G,
Widmer J,
Stapleton D,
Fernandez CS,
Kemp BE,
and
Witters LA.
Regulation of 5'-AMP-activated protein kinase activity by the noncatalytic beta and gamma subunits.
J Biol Chem
271:
17798-17803,
1996
15.
Fisher, JS,
Gao J,
Han DH,
Holloszy JO,
and
Nolte LA.
Activation of AMP kinase enhances sensitivity of muscle glucose transport to insulin.
Am J Physiol Endocrinol Metab
282:
E18-E23,
2002
16.
Foretz, M,
Carling D,
Guichard C,
Ferre P,
and
Foufelle F.
AMP-activated protein kinase inhibits the glucose-activated expression of fatty acid synthase gene in rat hepatocytes.
J Biol Chem
273:
14767-14771,
1998
17.
Frayn, KN.
Calculation of substrate oxidation rates in vivo from gaseous exchange.
J Appl Physiol
55:
628-634,
1983
18.
Fryer, LG,
Foufelle F,
Barnes K,
Baldwin SA,
Woods A,
and
Carling D.
Characterization of the role of the AMP-activated protein kinase in the stimulation of glucose transport in skeletal muscle cells.
Biochem J
363:
167-174,
2002[Web of Science][Medline].
19.
Fujii, N,
Hayashi T,
Hirshman MF,
Smith JT,
Habinowski SA,
Kaijser L,
Mu J,
Ljungqvist O,
Birnbaum MJ,
Witters LA,
Thorell A,
and
Goodyear LJ.
Exercise induces isoform-specific increase in 5'AMP-activated protein kinase activity in human skeletal muscle.
Biochem Biophys Res Commun
273:
1150-1155,
2000[Web of Science][Medline].
20.
Goodyear, LJ.
AMP-activated protein kinase: a critical signaling intermediary for exercise-stimulated glucose transport?
Exerc Sport Sci Rev
28:
113-116,
2000[Medline].
21.
Hardie, DG,
and
Hawley SA.
AMP-activated protein kinase: the energy charge hypothesis revisited.
Bioessays
23:
1112-1119,
2001[Web of Science][Medline].
22.
Hardie, DG,
Salt IP,
Hawley SA,
and
Davies SP.
AMP-activated protein kinase: an ultrasensitive system for monitoring cellular energy charge.
FEBS Lett
338:
717-722,
1999.
23.
Hawley, SA,
Davison M,
Woods A,
Davies SP,
Beri RK,
Carling D,
and
Hardie DG.
Characterization of the AMP-activated protein kinase kinase from rat liver and identification of threonine 172 as the major site at which it phosphorylates AMP-activated protein kinase.
J Biol Chem
271:
27879-27887,
1996
24.
Hawley, SA,
Selbert MA,
Goldstein EG,
Edelman AM,
Carling D,
and
Hardie DG.
5'-AMP activates the AMP-activated protein kinase cascade, and Ca2+/calmodulin activates the calmodulin-dependent protein kinase I cascade, via three independent mechanisms.
J Biol Chem
270:
27186-27191,
1995
25.
Holmes, BF,
Kurth-Kraczek EJ,
and
Winder WW.
Chronic activation of 5'-AMP-activated protein kinase increases GLUT-4, hexokinase, and glycogen in muscle.
J Appl Physiol
87:
1990-1995,
1999
26.
Houmard, JA,
Tyndall GL,
Midyette JB,
Hickey MS,
Dolan PL,
Gavigan KE,
Weidner ML,
and
Dohm GL.
Effect of reduced training and training cessation on insulin action and muscle GLUT-4.
J Appl Physiol
81:
1162-1168,
1996
27.
Hutber, CA,
Rasmussen BB,
and
Winder WW.
Endurance training attenuates the decrease in skeletal muscle malonyl-CoA with exercise.
J Appl Physiol
83:
1917-1922,
1997
28.
Kawanaka, K,
Nolte LA,
Han DH,
Hansen PA,
and
Holloszy JO.
Mechanisms underlying impaired GLUT-4 translocation in glycogen-supercompensated muscles of exercised rats.
Am J Physiol Endocrinol Metab
279:
E1311-E1318,
2000
29.
Lawson, JW,
and
Veech RL.
Effects of pH and free Mg2+ on the Keq of the creatine kinase reaction and other phosphate hydrolyses and phosphate transfer reactions.
J Biol Chem
254:
6528-6537,
1979
30.
Leclerc, I,
Kahn A,
and
Doiron B.
The 5'-AMP-activated protein kinase inhibits the transcriptional stimulation by glucose in liver cells, acting through the glucose response complex.
FEBS Lett
431:
180-184,
1998[Web of Science][Medline].
31.
Lochhead, PA,
Salt IP,
Walker KS,
Hardie DG,
and
Sutherland C.
5-Aminoimidazole-4-carboxamide riboside mimics the effects of insulin on the expression of the 2 key gluconeogenic genes PEPCK and glucose-6-phosphatase.
Diabetes
49:
896-903,
2000[Abstract].
32.
MacLean, PS,
Zheng D,
Jones JP,
Olson AL,
and
Dohm GL.
Exercise-induced transcription of the muscle glucose transporter (GLUT 4) gene.
Biochem Biophys Res Commun
292:
409-414,
2002[Web of Science][Medline].
33.
Mannion, AF,
Jakeman PM,
and
Willan PL.
Determination of human skeletal muscle buffer value by homogenate technique: methods of measurement.
J Appl Physiol
75:
1412-1418,
1993
34.
Markuns, JF,
Wojtaszewski JF,
and
Goodyear LJ.
Insulin and exercise decrease glycogen synthase kinase-3 activity by different mechanisms in rat skeletal muscle.
J Biol Chem
274:
24896-24900,
1999
35.
Musi, N,
Fujii N,
Hirshman MF,
Ekberg I,
Froberg S,
Ljungqvist O,
Thorell A,
and
Goodyear LJ.
AMP-activated protein kinase (AMPK) is activated in muscle of subjects with type 2 diabetes during exercise.
Diabetes
50:
921-927,
2001
36.
Neufer, PD,
and
Dohm GL.
Exercise induces a transient increase in transcription of the GLUT-4 gene in skeletal muscle.
Am J Physiol Cell Physiol
265:
C1597-C1603,
1993
37.
Passonneau, JV,
and
Lowry OH.
Enzymatic Analysis
a Practical Guide. Clifton, NJ: Humana, 1993.
38.
Perseghin, G,
Price TB,
Petersen KF,
Roden M,
Cline GW,
Gerow K,
Rothman DL,
and
Shulman GI.
Increased glucose transport-phosphorylation and muscle glycogen synthesis after exercise training in insulin-resistant subjects.
N Engl J Med
335:
1357-1362,
1996
39.
Phillips, SM,
Han XX,
Green HJ,
and
Bonen A.
Increments in skeletal muscle GLUT-1 and GLUT-4 after endurance training in humans.
Am J Physiol Endocrinol Metab
270:
E456-E462,
1996
40.
Pilegaard, H,
Ordway GA,
Saltin B,
and
Neufer PD.
Transcriptional regulation of gene expression in human skeletal muscle during recovery from exercise.
Am J Physiol Endocrinol Metab
279:
E806-E814,
2000
41.
Ponticos, M,
Lu QL,
Morgan JE,
Hardie DG,
Partridge TA,
and
Carling D.
Dual regulation of the AMP-activated protein kinase provides a novel mechanism for the control of creatine kinase in skeletal muscle.
EMBO J
17:
1688-1699,
1998[Web of Science][Medline].
42.
Putman, CT,
Jones NL,
Hultman E,
Hollidge-Horvat MG,
Bonen A,
McConachie DR,
and
Heigenhauser GJ.
Effects of short-term submaximal training in humans on muscle metabolism in exercise.
Am J Physiol Endocrinol Metab
275:
E132-E139,
1998
43.
Richter, EA,
Derave W,
and
Wojtaszewski JF.
Glucose, exercise and insulin: emerging concepts.
J Physiol
535:
313-322,
2001
44.
Richter, EA,
Macdonald C,
Kiens B,
Hardie DG,
and
Wojtaszewski JFP
Dissociation of 5'AMP-activated protein kinase activity and glucose clearance in human skeletal muscle during exercise (Abstract).
Diabetes
50:
A62,
2001.
45.
Salt, I,
Celler JW,
Hawley SA,
Prescott A,
Woods A,
Carling D,
and
Hardie DG.
AMP-activated protein kinase: greater AMP dependence, and preferential nuclear localization, of complexes containing the alpha2 isoform.
Biochem J
334:
177-187,
1998[Web of Science][Medline].
46.
Shimizu, S,
Inoue K,
Tani Y,
and
Yamada H.
Enzymatic microdetermination of serum free fatty acids.
Anal Biochem
98:
341-345,
1979[Web of Science][Medline].
47.
Stapleton, D,
Mitchelhill KI,
Gao G,
Widmer J,
Michell BJ,
Teh T,
House CM,
Fernandez CS,
Cox T,
Witters LA,
and
Kemp BE.
Mammalian AMP-activated protein kinase subfamily.
J Biol Chem
271:
611-614,
1996
48.
Stein, SC,
Woods A,
Jones NA,
Davison MD,
and
Carling D.
The regulation of AMP-activated protein kinase by phosphorylation.
Biochem J
345:
437-443,
2000[Web of Science][Medline].
49.
Stephens, TJ,
Chen ZP,
Canny BJ,
Michell BJ,
Kemp BE,
and
McConell GK.
Progressive increase in human skeletal muscle AMPK-
2 activity and ACC phosphorylation during exercise.
Am J Physiol Endocrinol Metab
282:
E688-E694,
2002
50.
Thornton, C,
Snowden MA,
and
Carling D.
Identification of a novel AMP-activated protein kinase beta subunit isoform that is highly expressed in skeletal muscle.
J Biol Chem
273:
12443-12450,
1998
51.
Tian, R,
Musi N,
D'Agostino J,
Hirshman MF,
and
Goodyear LJ.
Increased adenosine monophosphate-activated protein kinase activity in rat hearts with pressure-overload hypertrophy.
Circulation
104:
1664-1669,
2001
52.
Tullson, PC,
Whitlock DM,
and
Terjung RL.
Adenine nucleotide degradation in slow-twitch red muscle.
Am J Physiol Cell Physiol
258:
C258-C265,
1990
53.
Winder, WW.
Intramuscular mechanisms regulating fatty acid oxidation during exercise.
Adv Exp Med Biol
441:
239-248,
1998[Web of Science][Medline].
54.
Winder, WW.
Energy-sensing and signaling by AMP-activated protein kinase in skeletal muscle.
J Appl Physiol
91:
1017-1028,
2001
55.
Winder, WW,
Holmes BF,
Rubink DS,
Jensen EB,
Chen M,
and
Holloszy JO.
Activation of AMP-activated protein kinase increases mitochondrial enzymes in skeletal muscle.
J Appl Physiol
88:
2219-2226,
2000
56.
Wojtaszewski, JF,
Jorgensen SB,
Hellsten Y,
Hardie DG,
and
Richter EA.
Glycogen-dependent effects of 5-aminoimidazole-4-carboxamide (AICA)-riboside on AMP-activated protein kinase and glycogen synthase activities in rat skeletal muscle.
Diabetes
51:
284-292,
2002
57.
Wojtaszewski, JF,
Nielsen P,
Hansen BF,
Richter EA,
and
Kiens B.
Isoform-specific and exercise intensity-dependent activation of 5'-AMP-activated protein kinase in human skeletal muscle.
J Physiol
528:
221-226,
2000
58.
Woods, A,
Azzout-Marniche D,
Foretz M,
Stein SC,
Lemarchand P,
Ferre P,
Foufelle F,
and
Carling D.
Characterization of the role of AMP-activated protein kinase in the regulation of glucose-activated gene expression using constitutively active and dominant negative forms of the kinase.
Mol Cell Biol
20:
6704-6711,
2000
59.
Woods, A,
Salt I,
Scott J,
Hardie DG,
and
Carling D.
The
1 and
2 isoforms of the AMP-activated protein kinase have similar activities in rat liver but exhibit differences in substrate specificity in vitro.
FEBS Lett
397:
347-351,
1996[Web of Science][Medline].
60.
Yang, W,
Hong YH,
Shen XQ,
Frankowski C,
Camp HS,
and
Leff T.
Regulation of transcription by AMP-activated protein kinase: phosphorylation of p300 blocks its interaction with nuclear receptors.
J Biol Chem
276:
38341-38344,
2001
61.
Zheng, D,
MacLean PS,
Pohnert SC,
Knight JB,
Olson AL,
Winder WW,
and
Dohm GL.
Regulation of muscle GLUT-4 transcription by AMP-activated protein kinase.
J Appl Physiol
91:
1073-1083,
2001
This article has been cited by other articles:
![]() |
R. S. Lee-Young, B. J. Canny, D. E. Myers, and G. K. McConell AMPK activation is fiber type specific in human skeletal muscle: effects of exercise and short-term exercise training J Appl Physiol, July 1, 2009; 107(1): 283 - 289. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mounier, L. Lantier, J. Leclerc, A. Sotiropoulos, M. Pende, D. Daegelen, K. Sakamoto, M. Foretz, and B. Viollet Important role for AMPK{alpha}1 in limiting skeletal muscle cell hypertrophy FASEB J, July 1, 2009; 23(7): 2264 - 2273. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. A. Akerstrom, C. P. Fischer, P. Plomgaard, C. Thomsen, G. van Hall, and B. K. Pedersen Glucose ingestion during endurance training does not alter adaptation J Appl Physiol, June 1, 2009; 106(6): 1771 - 1779. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Williams, L. N. Sutherland, M. R. Bomhof, S. A. U. Basaraba, A. B. Thrush, D. J. Dyck, C. J. Field, and D. C. Wright Muscle-specific differences in the response of mitochondrial proteins to {beta}-GPA feeding: an evaluation of potential mechanisms Am J Physiol Endocrinol Metab, June 1, 2009; 296(6): E1400 - E1408. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Zwetsloot, L. M. Westerkamp, B. F. Holmes, and T. P. Gavin AMPK regulates basal skeletal muscle capillarization and VEGF expression, but is not necessary for the angiogenic response to exercise J. Physiol., December 15, 2008; 586(24): 6021 - 6035. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Wilkinson, S. M. Phillips, P. J. Atherton, R. Patel, K. E. Yarasheski, M. A. Tarnopolsky, and M. J. Rennie Differential effects of resistance and endurance exercise in the fed state on signalling molecule phosphorylation and protein synthesis in human muscle J. Physiol., August 1, 2008; 586(15): 3701 - 3717. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Thomson, C. A. Fick, and S. E. Gordon AMPK activation attenuates S6K1, 4E-BP1, and eEF2 signaling responses to high-frequency electrically stimulated skeletal muscle contractions J Appl Physiol, March 1, 2008; 104(3): 625 - 632. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Osler and J. R. Zierath Minireview: Adenosine 5'-Monophosphate-Activated Protein Kinase Regulation of Fatty Acid Oxidation in Skeletal Muscle Endocrinology, March 1, 2008; 149(3): 935 - 941. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Putman, K. J. B. Martins, M. E. Gallo, G. D. Lopaschuk, J. A. Pearcey, I. M. MacLean, R. J. Saranchuk, and D. Pette {alpha}-Catalytic subunits of 5'AMP-activated protein kinase display fiber-specific expression and are upregulated by chronic low-frequency stimulation in rat muscle Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2007; 293(3): R1325 - R1334. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Tosca, C. Chabrolle, S. Uzbekova, and J. Dupont Effects of Metformin on Bovine Granulosa Cells Steroidogenesis: Possible Involvement of Adenosine 5' Monophosphate-Activated Protein Kinase (AMPK) Biol Reprod, March 1, 2007; 76(3): 368 - 378. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Freyssenet Energy sensing and regulation of gene expression in skeletal muscle J Appl Physiol, February 1, 2007; 102(2): 529 - 540. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Ellingson, D. G. Chesser, and W. W. Winder Effects of 3-phosphoglycerate and other metabolites on the activation of AMP-activated protein kinase by LKB1-STRAD-MO25 Am J Physiol Endocrinol Metab, February 1, 2007; 292(2): E400 - E407. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Jorgensen, J. T. Treebak, B. Viollet, P. Schjerling, S. Vaulont, J. F. P. Wojtaszewski, and E. A. Richter Role of AMPK{alpha}2 in basal, training-, and AICAR-induced GLUT4, hexokinase II, and mitochondrial protein expression in mouse muscle Am J Physiol Endocrinol Metab, January 1, 2007; 292(1): E331 - E339. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Birk and J. F. P. Wojtaszewski Predominant {alpha}2/{beta}2/{gamma}3 AMPK activation during exercise in human skeletal muscle J. Physiol., December 15, 2006; 577(3): 1021 - 1032. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. De Filippis, K. Cusi, G. Ocampo, R. Berria, S. Buck, A. Consoli, and L. J. Mandarino Exercise-Induced Improvement in Vasodilatory Function Accompanies Increased Insulin Sensitivity in Obesity and Type 2 Diabetes Mellitus J. Clin. Endocrinol. Metab., December 1, 2006; 91(12): 4903 - 4910. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Li, D. L. Coven, E. J. Miller, X. Hu, M. E. Young, D. Carling, A. J. Sinusas, and L. H. Young Activation of AMPK {alpha}- and {gamma}-isoform complexes in the intact ischemic rat heart Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1927 - H1934. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Lee-Young, M. J. Palmer, K. C. Linden, K. LePlastrier, B. J. Canny, M. Hargreaves, G. D. Wadley, B. E. Kemp, and G. K. McConell Carbohydrate ingestion does not alter skeletal muscle AMPK signaling during exercise in humans Am J Physiol Endocrinol Metab, September 1, 2006; 291(3): E566 - E573. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Crawford, K. J. Treharne, S. Arnaud-Dabernat, J.-Y. Daniel, M. Foretz, B. Viollet, and A. Mehta Understanding the Molecular Basis of the Interaction between NDPK-A and AMPK {alpha}1 Mol. Cell. Biol., August 1, 2006; 26(15): 5921 - 5931. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Hardie, S. A. Hawley, and J. W. Scott AMP-activated protein kinase - development of the energy sensor concept J. Physiol., July 1, 2006; 574(1): 7 - 15. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Roepstorff, M. Thiele, T. Hillig, H. Pilegaard, E. A. Richter, J. F. P. Wojtaszewski, and B. Kiens Higher skeletal muscle {alpha}2AMPK activation and lower energy charge and fat oxidation in men than in women during submaximal exercise J. Physiol., July 1, 2006; 574(1): 125 - 138. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sriwijitkamol, J. L. Ivy, C. Christ-Roberts, R. A. DeFronzo, L. J. Mandarino, and N. Musi LKB1-AMPK signaling in muscle from obese insulin-resistant Zucker rats and effects of training Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E925 - E932. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Toyoda, S. Tanaka, K. Ebihara, H. Masuzaki, K. Hosoda, K. Sato, T. Fushiki, K. Nakao, and T. Hayashi Low-intensity contraction activates the {alpha}1-isoform of 5'-AMP-activated protein kinase in rat skeletal muscle Am J Physiol Endocrinol Metab, March 1, 2006; 290(3): E583 - E590. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Hancock, E. Janssen, and R. L. Terjung Contraction-mediated phosphorylation of AMPK is lower in skeletal muscle of adenylate kinase-deficient mice J Appl Physiol, February 1, 2006; 100(2): 406 - 413. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. K McConell, R. S Lee-Young, Z.-P. Chen, N. K Stepto, N. N Huynh, T. J Stephens, B. J Canny, and B. E Kemp Short-term exercise training in humans reduces AMPK signalling during prolonged exercise independent of muscle glycogen J. Physiol., October 15, 2005; 568(2): 665 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Hurst, E. B. Taylor, T. D. Cline, L. J. Greenwood, C. L. Compton, J. D. Lamb, and W. W. Winder AMP-activated protein kinase kinase activity and phosphorylation of AMP-activated protein kinase in contracting muscle of sedentary and endurance-trained rats Am J Physiol Endocrinol Metab, October 1, 2005; 289(4): E710 - E715. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. P Wojtaszewski, J. B Birk, C. Frosig, M. Holten, H. Pilegaard, and F. Dela 5'AMP activated protein kinase expression in human skeletal muscle: effects of strength training and type 2 diabetes J. Physiol., April 15, 2005; 564(2): 563 - 573. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Thomson and S. E. Gordon Diminished overload-induced hypertrophy in aged fast-twitch skeletal muscle is associated with AMPK hyperphosphorylation J Appl Physiol, February 1, 2005; 98(2): 557 - 564. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. B. Taylor, D. Hurst, L. J. Greenwood, J. D. Lamb, T. D. Cline, S. N. Sudweeks, and W. W. Winder Endurance training increases LKB1 and MO25 protein but not AMP-activated protein kinase kinase activity in skeletal muscle Am J Physiol Endocrinol Metab, December 1, 2004; 287(6): E1082 - E1089. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Clark, Z.-P. Chen, K. T. Murphy, R. J. Aughey, M. J. McKenna, B. E. Kemp, and J. A. Hawley Intensified exercise training does not alter AMPK signaling in human skeletal muscle Am J Physiol Endocrinol Metab, May 1, 2004; 286(5): E737 - E743. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Frosig, S. B. Jorgensen, D. G. Hardie, E. A. Richter, and J. F. P. Wojtaszewski 5'-AMP-activated protein kinase activity and protein expression are regulated by endurance training in human skeletal muscle Am J Physiol Endocrinol Metab, March 1, 2004; 286(3): E411 - E417. [Abstract] [Full Text] |
||||
![]() |
K. Hojlund, K. J. Mustard, P. Staehr, D. G. Hardie, H. Beck-Nielsen, E. A. Richter, and J. F. P. Wojtaszewski AMPK activity and isoform protein expression are similar in muscle of obese subjects with and without type 2 diabetes Am J Physiol Endocrinol Metab, February 1, 2004; 286(2): E239 - E244. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-P. Chen, T. J. Stephens, S. Murthy, B. J. Canny, M. Hargreaves, L. A. Witters, B. E. Kemp, and G. K. McConell Effect of Exercise Intensity on Skeletal Muscle AMPK Signaling in Humans Diabetes, September 1, 2003; 52(9): 2205 - 2212. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T Putman, M. Kiricsi, J. Pearcey, I. M MacLean, J. A Bamford, G. K Murdoch, W. T Dixon, and D. Pette AMPK activation increases uncoupling protein-3 expression and mitochondrial enzyme activities in rat muscle without fibre type transitions J. Physiol., August 15, 2003; 551(1): 169 - 178. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. P. Wojtaszewski, C. MacDonald, J. N. Nielsen, Y. Hellsten, D. G. Hardie, B. E. Kemp, B. Kiens, and E. A. Richter Regulation of 5'AMP-activated protein kinase activity and substrate utilization in exercising human skeletal muscle Am J Physiol Endocrinol Metab, April 1, 2003; 284(4): E813 - E822. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |