Journal of Applied Physiology Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Appl Physiol 91: 2182-2189, 2001;
8750-7587/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tesfaigzi, Y.
Right arrow Articles by Conn, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tesfaigzi, Y.
Right arrow Articles by Conn, C. A.
Vol. 91, Issue 5, 2182-2189, November 2001

Bcl-2 mediates sex-specific differences in recovery of mice from LPS-induced signs of sickness independent of IL-6

Yohannes Tesfaigzi1, Karin Rudolph1, Mark J. Fischer1, and Carole A. Conn1,2

1 Lovelace Respiratory Research Institute, Albuquerque 87185; and 2 Department of Nutrition, University of New Mexico, Albuquerque, New Mexico 87131


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Chronic pulmonary diseases are more common in boys than in girls. Therefore, we investigated the differences in signs of sickness in male and female mice that were exposed to lipopolysaccharide (LPS) by intranasal instillation. Because apoptosis is important in the resolution of inflammation, we tested the hypothesis that reduced levels of Bcl-2, a regulator of apoptosis, may play a role in gender-specific differences in response to inflammation. Bcl-2 wild-type (+/+) female mice recovered from an LPS-induced drop in body temperature and loss in body weight significantly faster than male (+/+) mice. Female heterozygous (+/-) mice showed reduced Bcl-2 levels and exhibited a slower recovery than female (+/+) mice that was similar to the recovery pattern in male (+/+) and (+/-) mice. Interleukin-6 (IL-6) activity levels in the bronchoalveolar lavage fluid were higher in male than in female mice but were not different between (+/+) and (+/-) mice. We conclude that Bcl-2 plays a role in mediating the faster recovery of female (+/+) mice from LPS-induced signs of sickness independent of IL-6. These studies indicate that apoptotic mechanisms may be involved in gender-specific differences in chronic pulmonary diseases.

apoptosis; hypothermia; cytokines; inflammation; mucus


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

ASTHMA AND CHILDHOOD WHEEZE are more common and more severe in boys than in girls (29). Between 2 and 14 yr of age, boys are four times more likely to develop chronic asthma than girls (29) and are twice as likely to be hospitalized for asthma (35). Similarly, longitudinal studies in children with cystic fibrosis revealed that pulmonary function is decreased significantly more in boys than in girls (45). These studies suggest a vulnerability of boys to chronic pulmonary inflammation and identify the importance of investigating the cause of gender differences for these diseases.

Airborne endotoxins, lipopolysaccharides (LPS) from the cell walls of gram-negative bacteria, are potent proinflammatory substances that can induce airway obstruction and potentiate the obstructive response to subsequent stimuli (25). Exposure to LPS occurs by inhalation of endotoxin-contaminated water or certain types of organic dusts (2, 11, 32, 34). Exposure of mice to LPS by intranasal or intratracheal instillations has been used as models for inflammatory diseases, such as cystic fibrosis, chronic bronchitis, and pneumonia (10, 40, 41).

Mice injected with LPS, generally used as a model of systemic inflammatory response syndrome, develop an acute phase response accompanied by sickness symptoms such as hypothermia, fever, anorexia (i.e., decreased food intake), and cachexia (i.e., decreased body weight) (23). Several lines of evidence support the hypothesis that interleukin (IL)-6 and tumor necrosis factor (TNF)-alpha play a role in this syndrome (4, 22, 24). Furthermore, LPS injection causes oligonucleosomal and random DNA fragmentation in several organs, including the lung (3). Inhibition of caspase activity in these mice prevents the LPS-induced apoptosis and acute lung injury (14). Decreased or suppressed apoptosis of immune effector cells in inflamed tissues is crucial for the evolution of an inflammatory process in different organs (43). Furthermore, apoptotic cell death plays a critical role in the clearance of inflamed tissue and recovery from the inflammatory response (6, 7). It is also involved in the resolution of LPS-induced alveolar type II cell hyperplasia (39). The Bcl-2 protein enhances cell survival by inhibiting apoptosis induced under a wide variety of circumstances in leukocytes and in several epithelial tissues (30), suggesting that this protein acts at a central control point in the pathway to apoptotic cell death (1).

Although the effects of LPS administered by injection have been studied extensively, the effects of LPS exposure through the respiratory tract on body temperature and other inflammatory responses have not been well characterized. We wanted to establish whether there are differences in clinical symptoms between young male and female mice that were exposed to LPS through the respiratory system. Furthermore, we hypothesized that Bcl-2 as a regulator of apoptosis may be involved in the gender-specific differences in LPS-induced inflammatory disease. Therefore, we examined the effects of reduced Bcl-2 levels on LPS-induced inflammatory response and symptoms of illness. We describe differences in the clinical outcomes in male and female mice after intranasal instillation with LPS and demonstrate that even reduced levels of Bcl-2 affect the gender-specific differences in the recovery from LPS-induced physiological and behavioral signs of sickness.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animals. Breeder mice heterozygous for the Bcl-2 gene [Bcl-2-(+/-)] were obtained from Dr. Stanley Korsmeyer (Washington University School of Medicine, St. Louis, MO) and were bred in our barrier facility. The generation of Bcl-2 heterozygous mice by gene targeting and the genetic background of these mice are described elsewhere (42). Bcl-2 knockout (-/-) mice complete embryonic development but display early mortality postnatally (42) because of involution of the thymus and spleen and abnormal morphogenesis of the kidney and renal failure due to extensive apoptosis (27). Heterozygous (+/-) mice express less Bcl-2 protein than wild-type (+/+) animals; however, (+/+) and (+/-) mice show no significant differences in their development and life span (28, 36). Therefore, Bcl-2 heterozygous mice were used for the following experiments.

Offspring were genotyped by polymerase chain reaction using the primer pair TCCTCGTGCTTTACGGTATC and TAAGTCTGAGCTCAGAGACC to amplify across the Bcl-2 and the neo genes to identify (+/-) mice. The primer pair CTTTGTGGAACTGTACGGCCCCAGCATGCG and ACAGCCTGCAGCTTTGTTTCATGGTACATC was used to amplify the Bcl-2 gene across the area where the neo gene was inserted for identification of (+/+) mice. Age- and gender-matched control and Bcl-2 (+/-) littermates were used for each experiment.

Animal care. The Lovelace Respiratory Research Institute's Animal Care and Use Committee approved all care and treatment of the mice. All mice were housed in individual plastic cages and maintained in a temperature-, humidity-, and light-controlled chamber set at 30 ± 1°C, with a 12:12-h light-dark cycle with lights on at 6 AM. Rodent laboratory chow and drinking water were provided ad libitum. Once the mice reached 6-8 wk of age, biotelemetry devices to monitor body temperature and motor activity were implanted under sterile conditions.

Body temperature measurement and locomotor activity. One week before the start of the experiment, mice were implanted intraperitoneally with battery-operated biotelemeters (model VMFH, Mini-Mitter, Sunriver, OR) as described previously (17). Each transmitter was calibrated to ±0.1°C before implantation. Signals from the telemeters were collected by receivers (model RA1010, Mini-Mitter) placed beneath the floor of each cage. The frequency emitted by the transmitters is proportional to the abdominal temperature of the mice. Experiments were started after a regular rhythm of body temperature and activity in freely moving mice had been monitored for >= 3 days. Motor activity of the mice was measured with the biotelemetry system described above. Briefly, in this system, changes in activity are detected by changes in position of the implanted transmitter over the receiver board. This results in a change of the signal strength that is detected by the receiver and recorded as a "pulse" or "count" of activity. As the animal moved freely in the cage, an activity count was generated whenever the signal strength received by the antennas was altered more than the previously set limit for change. These counts were stored per unit time and provided an index of general locomotor activity. Recordings were made at 5-min intervals through a peripheral processor (Datacol III System) connected to an IBM personal computer.

Body weight and intake of food and water. Body weight and food and water intake were monitored daily by weighing each mouse on a top-loading balance accurate to ±0.1 g (Sartorius model MP 1206, Brinkman Instruments, Westbury, NY) between 8 and 10 AM.

LPS instillations. Mice were intranasally instilled with 180 µg of LPS once only, with 60 µg of LPS in 50 µl of saline on 3 consecutive days, or with 50 µl of saline only as a control during a short period of anesthesia. To avoid any circadian variation in body temperature, all instillations were made between 8 and 10 AM.

Necropsy and tissue preparation. Thoracic contents were exposed, and the lungs were perfused through the pulmonary artery with phosphate-buffered saline (Life Technologies, Grand Island, NY). The trachea and lungs were isolated, and each was lavaged three times with 1.5 ml of ice-cold medium 199. The lavage fluid was collected. The lung was expanded to inspiratory volume by intratracheal instillation of 10% zinc formalin (Stephens Scientific, Riverdale, NJ) at 25 cmH2O constant pressure for 3-4 h, as described elsewhere (37). Then the lung was immersed in the same fixative for 3-4 days.

Western blot analysis. Protein extracts were prepared from the entire right lung or entire spleen of (+/+) and (+/-) mice by homogenization in RIPA buffer (10 mM Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% deoxycholate, 0.1% SDS, and 5 mM EDTA) supplemented with the protease inhibitors phenylmethylsulfonyl fluoride (1 mM), pepstatin (10 µg/ml), aprotinin (2 µg/ml), and benzamidine (2 µg/ml). Protein concentration was determined using the bicinchoninic acid assay kit (Pierce, Rockford, IL); 120 µg of protein from each sample were loaded on each lane. Western blotting was carried out as described earlier (38), and filters were incubated with antibodies to actin (Santa Cruz Biotechnology, Santa Cruz, CA) to confirm that equivalent amounts of protein had been loaded on each lane. The antibodies to Bcl-2 (Pharmingen, San Diego, CA) and actin were used at 1:1,000 dilution.

Histopathology. The fixed lung was cut into slices, each ~4 mm thick. Three to four slices were prepared, depending on the size of the lung, and slices were embedded in paraffin. Each slice was placed down so that the tissue sections represent the lung sequentially from cranial to caudal when 5-µm sections were prepared from the embedded tissues for staining with alcian blue to detect mucous cells. The number of mucous cells in all airways of the tissues sections was determined by counting all alcian blue-positive cells in the airways of the tissue sections prepared from each lung.

Quantification of neutrophils and macrophages. Cells recovered by lavage of the lungs were enumerated using a hemocytometer. Cytological specimens were prepared and stained with Wright-Giemsa (Fisher Scientific, Pittsburgh, PA) to determine the different types of cells present in the bronchoalveolar lavage fluid (BALF). Four hundred cells were counted from each slide to determine a percent distribution of the different cell types. The total numbers of each cell type were then calculated by multiplying the percentage distribution of the respective cell types by the total cell numbers obtained by lavage.

Bioassays for IL-6 and TNF-alpha . IL-6 and TNF bioactivity was measured in the BALF using the IL-6-dependent B-9 hybridoma cell line and the TNF-sensitive WEHI-164 subclone 13 cell line, essentially as described previously (5, 20). Briefly, the basis for the IL-6 bioassay is that the hybridoma cells are IL-6 dependent and replicate in direct proportion to the quantity of IL-6 present (21). The basis of the bioassay for TNF is that this cytokine is toxic to the fibroblast cell line (5). Cells were resuspended in medium before addition of the lavage samples or known amounts of recombinant cytokines. Triplicate standards and triplicate test samples were incubated with cells; cell growth was assayed by the addition of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and estimated by colorimetric assay. Because we did not neutralize the activities in the BALF with antibodies to IL-6 or TNF, the measured activity must be considered "IL-6- or TNF-like."

Data analysis. Three separate experiments were conducted, and combined data are presented as means ± SE. A three-factor ANOVA was used to test for differences among groups for changes in cytokine levels and mucous and inflammatory cell numbers in the BALF. For samples in which the activity of a cytokine was below the level of detection of the appropriate assay, the value zero was used in calculations of group means. Temperature and activity data, collected at 5- to 15-min intervals, were averaged over 12 h and analyzed.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Changes in body temperature after one high-dose and three low-dose instillations with LPS. Although most organisms are primarily exposed to LPS through the respiratory tract, our understanding of physiological and behavioral changes after intranasal instillation of LPS in mice is limited. Undisturbed C57Bl/6 mice kept at an ambient temperature of 30°C on a 12:12-h light-dark cycle revealed a rhythm in body temperature having two phases: a nighttime rise, then a daytime fall. Intranasal instillation of 50 µl of saline one or three times on consecutive days did not disturb the rhythm in body temperature, but the rhythm was disturbed after a single instillation of 180 µg of LPS in 50 µl of saline (Fig. 1). The body temperature did not rise during the night and stayed at daytime temperatures during the ensuing 3-day period. However, three consecutive daily instillations of 60 µg of LPS each caused the body temperature to decrease drastically (Fig. 1B). After the first inoculation, decreases to levels observed after a one-time instillation of 180 µg of LPS were observed. The second instillation caused a further decrease of ~0.5°C, and the body temperatures fell by ~2-3°C after the third LPS instillation. At 3 days after the final instillation, the body temperature recovered to values comparable to those of mice that were instilled only once. To maximize clinical symptoms, all further experiments were carried out by instilling mice on 3 consecutive days with 60 µg of LPS.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1.   Changes in body temperature after a single intranasal instillation with 1 high dose (180 µg) or 3 consecutive instillations with a 3-fold lower dose (60 µg) of lipopolysaccharide (LPS). Effects of 1 or 3 intranasal instillations with saline (A) or LPS (B) are shown. Only male C57Bl/6 mice were used. Arrows, time of instillations (-2, -1, and 0 days), 0 days representing the time of the last LPS treatment. Numbers in parentheses are sample sizes. Values are means ± SE of 12-h averages.

Bcl-2 levels in the spleens and lungs from (+/+) and (+/-) mice. The abundance of Bcl-2 was determined in (+/+) and (+/-) mice by Western blot analysis. In the spleen, Bcl-2 was detected in the (+/+) and (+/-) mice; however, as previously shown by others (42), Bcl-2 levels in (+/-) mice were about half those in the wild-type mice, confirming that mice were correctly allelotyped as Bcl-2 (+/+) and (+/-) mice (Fig. 2). The actin levels demonstrate that the same amounts of protein from (+/+) and (+/-) mice were analyzed. Similar results were obtained when Bcl-2 levels were examined in lung extracts (data not shown).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2.   Detection of Bcl-2 by Western blot analysis in spleens of wild-type (lane 1) and heterozygous mice (lane 2). Protein was extracted from spleens, and 120 µg of protein were analyzed by Western blotting using antibodies to Bcl-2 and actin at 1:1,000 dilution. Although the same levels of actin were detected for lanes 1 and 2, Bcl-2 levels were higher in wild-type than in heterozygous mice.

Female (+/+) mice recover faster than female (+/-) mice from an LPS-induced decrease in body temperature and motor activity. Male and female Bcl-2 (+/+) and (+/-) mice housed at 30°C on a 12:12-h light-dark cycle displayed a regular rhythm in body temperature. Female mice, regardless of their genotype, had significantly higher body temperatures before LPS instillation (Fig. 3) and were more active during dark periods (data not shown) than male mice. Because maximum changes were observed with three consecutive LPS instillations, this protocol was used for determining the role of reduced Bcl-2 levels on LPS-induced changes in body temperature and other physiological end points. Saline instillations on 3 consecutive days produced no significant difference in body temperature among groups (Fig. 3A). However, after three instillations of 60 µg of LPS, the female (+/+) mice recovered significantly faster from the LPS-induced decrease in body temperature than the male (+/+) mice (Fig. 3B). Interestingly, the gender difference in the recovery from LPS-induced reduction in body temperature was not observed in Bcl-2 (+/-) mice (Fig. 3C). Male and female (+/-) mice did not differ, and their rates of recovery were similar to that observed in male (+/+) mice. Furthermore, the female (+/+) mice recovered significantly faster than the female (+/-) mice. The difference between male (+/+) and (+/-) mice was not significant. Similar results were obtained for the activity measurements in these mice (data not shown).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3.   Body temperature before and after 3 intranasal instillations with 50 µl of saline (A) and 60 µg of LPS in 50 µl of saline in female and male Bcl-2 wild-type (WT, B) and heterozygous (HZ, C) mice. Mice were instilled at -2, -1, and 0 days (arrows), 0 days representing the time of the last LPS treatment. Three-way ANOVA showed that the gender × genotype × time interaction was significant at P = 0.03 and the gender × genotype interaction was significant at P = 0.016. Sample sizes (n) shown in parentheses decrease as mice are killed daily after instillation. Values are means ± SE of 12-h averages (day and night). Before LPS instillation, body temperature was significantly (P = 0.001) higher in female than in male mice. Between 36 and 60 h after LPS instillation, female wild-type mice had significantly (P < 0.03) higher body temperature than female heterozygous and male wild-type and heterozygous mice. Female and male heterozygous mice were not significantly different from each other or from the wild-type mice.

Female (+/+) mice recover faster than female (+/-) mice from LPS-induced decrease in body weight. The weight of the mice in the different groups was not significantly different from each other 2 days before saline instillation (21.4 to 23.7 g). At 3 days after saline instillation, male mice showed a larger increase in body weight than female mice, which is consistent with the faster growth of male mice (Fig. 4A). LPS instillation induced a significant loss of body weight in all groups (Fig. 4, B and C). The female (+/+) mice lost significantly less body weight than the male (+/+) mice and recovered to the original body weight within 4 days (Fig. 4B). The difference in body weight between the male and female (+/-) mice was significantly different only at day 1, and both groups of mice did not recover their original body weight by day 4 after LPS instillation (Fig. 4C). Similar observations were made for the LPS-induced decrease in water and food intake, whereby the changes in water and food intake precede the changes observed in weight changes (data not shown). Therefore, the LPS-induced weight loss is likely to be primarily a result of decreased food intake.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 4.   Change of body weight before and after 3 intranasal instillations with 50 µl of saline (A) and 60 µg of LPS in 50 µl of saline in female and male Bcl-2 wild-type (B) and heterozygous (C) mice. Mice were instilled at -2, -1, and 0 days (arrows). Sample sizes (n) shown in parentheses decrease as mice are killed daily after instillation. Error bars, SE. Three-way ANOVA showed that the gender × genotype interaction was significant at P = 0.038, and the gender × time interaction was significant at P = 0.005. Female wild-type mice had a significantly (P < 0.03) attenuated change in body weight compared with any other group. Female heterozygous mice lost significantly (P < 0.03) more weight than female wild-type mice but significantly (P < 0.03) less than both male groups. The male groups lost significantly (P < 0.003) more weight than all female mice.

LPS-induced changes in IL-6 and TNF-alpha activity in the BALF and plasma. IL-6 activity could not be detected in BALF from any of the saline-instilled mice. However, IL-6 activity in BALF from LPS-instilled mice was significantly elevated on days 1 and 2 (Fig. 5). Among the LPS-instilled mice, male mice had significantly higher IL-6 activity in the BALF than female mice on day 1 after inoculation. In male and female mice, IL-6 activity had returned to undetectable levels by day 4. On day 3 after LPS inoculation, male mice, but not female mice, had significantly elevated levels of IL-6 in the BALF. These results indicate that male mice had a more pronounced IL-6 response in the lung than female mice and were delayed in returning to the normal undetectable levels of IL-6 activity after inoculation compared with female mice. However, there were no significant differences between heterozygous and wild-type mice in BALF IL-6 activity for any day after inoculation.


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5.   Interleukin-6 (IL-6) activity levels in bronchoalveolar lavage fluid (BALF) of male (A) and female (B) mice killed 1, 2, 3, and 4 days after instillation. Three-way ANOVA showed that the gender × time interaction was significant at P = 0.099. On day 1, IL-6 activity levels in BALF of male mice were significantly (P < 0.03) higher than in BALF of female mice. IL-6 activity levels in LPS-instilled mice were significantly (P < 0.03) different from zero on days 1 and 2 for female mice and on days 1, 2, and 3 for male mice; no saline-instilled mice showed IL-6 activity in the BALF. Numbers in parentheses indicate sample size. Error bars, SE.

TNF-alpha activity was not elevated in BALF from LPS-instilled mice compared with saline-instilled mice at any time from day 1 through day 4 after inoculation (data not shown). Neither IL-6 nor TNF-alpha activity was significantly elevated in plasma from the saline- or LPS-instilled mice on any day after inoculation (data not shown).

LPS-induced changes in inflammatory cells from the BALF. Infiltration of the lung by inflammatory cells was analyzed to determine its association with the observed physiological changes. Mice instilled with saline had low cell counts in BALF. Only neutrophils and macrophages were found in significant numbers in BALF from the four LPS-instilled groups of mice. The numbers of neutrophils were highest at day 1 after LPS instillation and gradually decreased to background levels over 4 days (Fig. 6A). No significant differences could be observed on any day among the four groups treated with LPS. The numbers of macrophages were significantly elevated relative to saline groups by day 1, remained elevated over 3 days, and decreased to background levels at day 4 (Fig. 6B). The number of infiltrating lymphocytes was similar to that observed for macrophages and showed no significant differences among groups over the 4 days after instillation (data not shown). Mucous cells in airway epithelia were significantly increased after LPS, but not saline, instillation on days 3 and 4 after instillation. At days 2, 3, and 4 after LPS instillation, the numbers of mucous cells were not significantly different among the four groups of mice (data not shown).


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 6.   Number of neutrophils (A) and macrophages (B) in the BALF of mice killed 1, 2, 3, and 4 days after instillation. Numbers decreased from ~10 × 106 cells at day 1 to background levels over 4 days. Macrophage numbers decreased to background levels 4 days after LPS instillation. No significant differences were observed among the different groups of mice. Number of neutrophils and macrophages did not increase significantly from background levels in saline-instilled mice (data not shown). Numbers in parentheses indicate sample size. Error bars, SE.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The major conclusions from this study are that the faster recovery of female (+/+) than male (+/+) mice from LPS-induced signs of sickness is abrogated when Bcl-2 levels are reduced. This effect of Bcl-2 is independent of IL-6 levels and independent of the influx and clearance of inflammatory cells in the lungs.

A single intranasal instillation of 60 or 180 µg of LPS caused similar effects in the decrease in body temperature, indicating that at these high doses the body temperature is not affected in a dose-dependent manner. However, three consecutive instillations of 60 µg of LPS caused a drastic reduction in body temperature, confirming that repeated exposures exacerbate the detrimental effects of environmental toxins (13, 31, 33). The drop in body temperature was not followed by fever, as was observed for LPS injected intraperitoneally (15, 23), indicating a difference in the inflammatory response depending on the route of LPS administration. Intranasal inoculation of mice with influenza virus causes decreased body temperature, general locomotor activity, and food and water intake (5, 16). The similarity in the effects of LPS or viral DNA administered through the respiratory tract suggests that the localization of the inflammatory response may be critical in the observed physiological changes. Influenza pneumonitis in mice is associated with a dose-dependent decrease in blood oxygen saturation (16). Hypoxia itself can induce production of cytokines, including IL-6 (9), depress metabolism, and decrease body temperature. Therefore, one mechanism underlying the intranasal instillation of LPS-induced hypothermia may also involve pneumonitis-induced hypoxia.

All groups of mice showed increased neutrophils, macrophages, and lymphocytes in the BALF followed by increased mucous cell numbers over the 4 days after LPS instillation. However, the numbers of these inflammatory indicators were not statistically different among genders and/or genotypes, suggesting that Bcl-2 levels in (+/-) mice were sufficient for inflammatory cell migration and clearance and the development of mucous cell metaplasia in the lung airways.

The female (+/+) mice recovered significantly faster than the male (+/+) mice from hypothermia, cachexia, and anorexia after three intranasal instillations of LPS. Immune activation, which results in cytokine production, is modulated by circulating hormones, such as glucocorticoids and gonadal hormones (18). There is evidence that spleen cells from female mice have altered immune responses compared with those from male mice, which may be mediated by gender-specific hormones (18). Another study suggests that female mice eliminate the Coxsackie B-3 virus faster than male mice (12). Therefore, the faster recovery of female mice in the present study may be due to a faster development of tolerance to LPS or to an enhanced clearance of LPS by phagocytic cells. Immune responses change during the estrous cycle in rodents (19). Fever induced by IL-1beta injection in rats was significantly higher and more prolonged in females at proestrus than at diestrus (26). In the present study, mice were not selected for the different stages of the estrous cycle; however, the faster recovery of female mice from the LPS-induced decrease in body temperature was consistent in three different experiments. The data presented in this study are combined from three independent experiments balanced for all experimental groups in which each replication consistently showed a difference in the female wild-type mice. These results suggest that female mice recover faster than male mice regardless of their stage in the estrous cycle or that the effect of the different stages was not diluted by female mice in the inactive stages of the cycle.

The female (+/+) mice recovered significantly faster than the female (+/-) and male mice from the LPS-induced signs of sickness. However, the rate of recovery of female and male (+/-) mice was statistically not significantly different, suggesting that mice with reduced levels of Bcl-2 do not show the gender-specific difference in recovery. Furthermore, this result implies that the immune system of female (+/+) mice responds in a manner similar to that of male (+/+) mice when Bcl-2 levels are reduced.

Our data and many other studies implicate IL-6 as one of the cytokines involved in the observed LPS-induced inflammatory responses. It is well established that IL-6 levels increase drastically after LPS exposure in several species (20, 44). In this study, male (+/+) mice had higher levels of IL-6 at day 1 after LPS instillation than female (+/+) mice. The inflammatory response comprises many aspects. Although male mice did not have a higher influx of neutrophils, one indicator of an inflammatory response, the increased IL-6 levels in male mice compared with female mice, indicates that male mice had a higher inflammatory response to LPS instillation. Similarly, significantly increased plasma IL-6 concentrations were also found in male but not in female mice that were subjected to hypoxemia (14a). By day 3 after LPS instillation, IL-6 activity in the BALF from female mice had already returned to undetectable levels, whereas IL-6 activity from male mice remained significantly elevated. This difference in cytokine activity levels in the BALF correlates with the faster recovery of female (+/+) mice from symptoms of illness. IL-6 appears to be involved in the LPS-induced clinical symptoms; however, no significant differences in IL-6 levels were observed between the female (+/+) and (+/-) mice at this or any time point analyzed. This observation suggests that the lower levels of Bcl-2 in heterozygotes are still sufficient to elicit a female IL-6 response and that Bcl-2 is not acting through IL-6 in its role to mediate the faster recovery of female (+/+) mice than the other groups of mice from LPS-induced inflammation. TNF-alpha levels are known to increase at early time points (2 h) post-LPS exposure and decrease to background levels after 6 h (13a). In this study, the measurements were done in the BALF obtained 24 h postinoculation, by which time TNF-alpha levels may have been reduced to undetectable levels.

Hormones modulate expression of apoptotic factors in lymphoid cell death, and Bcl-2 is upregulated by estrogen in several tissues (8). Inflammatory cell numbers in the BALF were not different among all LPS-treated groups, indicating that the clearance of inflammatory cells is not affected by decreased Bcl-2 levels. However, it is possible that reduced levels of Bcl-2 expression in heterozygous female mice inactivate the estrogen-dependent immune response of certain leukocytes to LPS. Because Bcl-2 is modulated by estradiol in some brain neurons (8), it is also possible that Bcl-2 levels have a direct effect on thermoregulatory or appetite centers in the brain. Further research is warranted to determine whether certain cells have reduced Bcl-2 levels in male compared with female mice and to identify the mechanisms by which Bcl-2 mediates the faster recovery in female mice. These studies are crucial to understand the molecular basis of sex-specific differences in chronic pulmonary diseases.


    ACKNOWLEDGEMENTS

The authors thank Yoneko Knighton for preparation of tissue samples and Dr. Margaret Ménache for valuable advice on solving the statistical problems.


    FOOTNOTES

Lovelace Respiratory Research Institute is fully accredited by the International Association for the Assessment and Accreditation of Laboratory Animal Care.

These studies were sponsored by grants from the American Lung Association and National Institute of Environmental Health Sciences Grant ES-09237 (Y. Tesfaigzi).

Address for reprint requests and other correspondence: Y. Tesfaigzi, Lovelace Respiratory Research Institute, 2425 Ridgecrest Dr., Albuquerque, NM 87108 (E-mail: ytesfaig{at}lrri.org).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 23 March 2001; accepted in final form 28 June 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Adams, JM, and Cory S. The Bcl-2 protein family: arbiters of cell survival. Science 281: 1322-1326, 1998[Abstract/Free Full Text].

2.   Blaski, C, Clapp W, Thorne P, Quinn T, Watt J, Fress K, Yagla S, and Schwartz D. The role of atopy in grain dust-induced airway disease. Am J Respir Crit Care Med 154: 334-340, 1996[Abstract].

3.   Bohlinger, I, Leist M, Gantner F, Angermuller S, Tiegs G, and Wendel A. DNA fragmentation in mouse organs during endotoxic shock. Am J Pathol 149: 1381-1393, 1996[Abstract].

4.   Chai, Z, Gatti S, Toniatti C, Poli V, and Bartfai T. Interleukin (IL)-6 gene expression in the central nervous system is necessary for fever response to lipopolysaccharide or IL-1beta : a study on IL-6-deficient mice. J Exp Med 183: 311-316, 1996[Abstract/Free Full Text].

5.   Conn, C, McClellan J, Maassab H, Smitka C, Majde J, and Kluger M. Cytokines and the acute phase response to influenza virus in mice. Am J Physiol Regulatory Integrative Comp Physiol 268: R78-R84, 1995[Abstract/Free Full Text].

6.   Cox, G, Crossley J, and Xing Z. Macrophage engulfment of apoptotic neutrophils contributes to the resolution of acute pulmonary inflammation in vivo. Am J Respir Cell Mol Biol 12: 232-237, 1995[Abstract].

7.   Coxon, A, Rieu P, Barkalow FJ, Askari S, Sharpe AH, von Andrian UH, Arnaout MA, and Mayadas TN. A novel role for the beta 2-integrin CD11b/CD18 in neutrophil apoptosis: a homeostatic mechanism in inflammation. Immunity 5: 653-666, 1996[Web of Science][Medline].

8.   Garcia-Segura, LM, Cardona-Gomez P, Naftolin F, and Chowen JA. Estradiol upregulates Bcl-2 expression in adult brain neurons. Neuroreport 9: 593-597, 1998[Web of Science][Medline].

9.   Ghezzi, P, Dinarello CA, Bianchi M, Rosandich ME, Repine JE, and White CW. Hypoxia increases production of interleukin-1 and tumor necrosis factor by human mononuclear cells. Cytokine 3: 189-194, 1991[Web of Science][Medline].

10.   Harkema, JR, and Hotchkiss JA. In vivo effects of endotoxin on intraepithelial mucosubstances in rat pulmonary airways. Quantitative histochemistry. Am J Pathol 141: 307-317, 1992[Abstract].

11.   Harkema, JR, and Hotchkiss JA. Ozone- and endotoxin-induced mucous cell metaplasias in rat airway epithelium: novel animal models to study toxicant-induced epithelial transformation in airways. Toxicol Lett 68: 251-263, 1993[Web of Science][Medline].

12.   Huber, SA, Job LP, and Auld KR. Influence of sex hormones on Coxsackie B-3 virus infection in Balb/c mice. Cell Immunol 67: 173-179, 1982[Web of Science][Medline].

13.   Jagielo, P, Thorne P, Kern J, Quinn T, and Schwartz D. Role of endotoxin in grain dust-induced lung inflammation in mice. Am J Physiol Lung Cell Mol Physiol 270: L1052-L1059, 1996[Abstract/Free Full Text].

13a.   Johnston, CJ, Finkelstein JN, Gelein R, and Oberdorster G. Pulmonary cytokine and chemokine mRNA levels after inhalation of lipopolysaccharide in C57BL/6 mice. Toxicol Sci 46: 300-307, 1998[Abstract/Free Full Text].

14.   Kawasaki, M, Kuwano K, Hagimoto N, Matsuba T, Kunitake R, Tanaka T, Maeyama T, and Hara N. Protection from lethal apoptosis in lipopolysaccharide-induced acute lung injury in mice by a caspase inhibitor. Am J Pathol 157: 597-603, 2000[Abstract/Free Full Text].

14a.   Knoferl, MW, Jarrar D, Schwacha MG, Angele MK, Cioffi WG, Bland KI, and Chaudry IH. Severe hypoxemia in the absence of blood loss causes a gender dimorphic immune response. Am J Physiol Cell Physiol 279: C2004-C2010, 2000[Abstract/Free Full Text].

15.   Kozak, W, Kluger MJ, Soszynski D, Conn CA, Rudolph K, Leon LR, and Zheng H. IL-6 and IL-1beta in fever. Studies using cytokine-deficient (knockout) mice. Ann NY Acad Sci 856: 33-47, 1998[Web of Science][Medline].

16.   Kozak, W, Poli V, Soszynski D, Conn CA, Leon LR, and Kluger MJ. Sickness behavior in mice deficient in interleukin-6 during turpentine abscess and influenza pneumonitis. Am J Physiol Regulatory Integrative Comp Physiol 272: R621-R630, 1997[Abstract/Free Full Text].

17.   Kozak, W, Zheng H, Conn CA, Soszynski D, van der Ploeg LH, and Kluger MJ. Thermal and behavioral effects of lipopolysaccharide and influenza in interleukin-1beta -deficient mice. Am J Physiol Regulatory Integrative Comp Physiol 269: R969-R977, 1995[Abstract/Free Full Text].

18.   Krzych, U, Strausser HR, Bressler JP, and Goldstein AL. Effects of sex hormones on some T and B cell functions, evidenced by differential immune expression between male and female mice and cyclic pattern of immune responsiveness during the estrous cycle in female mice. Am J Reprod Immunol 1: 73-77, 1981.

19.   Krzych, U, Strausser HR, Bressler JP, and Goldstein AL. Quantitative differences in immune responses during the various stages of the estrous cycle in female BALB/c mice. J Immunol 121: 1603-1605, 1978[Abstract/Free Full Text].

20.   LeMay, DR, LeMay LG, Kluger MJ, and D'Alecy LG. Plasma profiles of IL-6 and TNF with fever-inducing doses of lipopolysaccharide in dogs. Am J Physiol Regulatory Integrative Comp Physiol 259: R126-R132, 1990[Abstract/Free Full Text].

21.   LeMay, LG, Otterness IG, Vander AJ, and Kluger MJ. In vivo evidence that the rise in plasma IL-6 following injection of a fever-inducing dose of LPS is mediated by IL-1beta . Cytokine 2: 199-204, 1990[Medline].

22.   LeMay, LG, Vander AJ, and Kluger MJ. Role of interleukin 6 in fever in rats. Am J Physiol Regulatory Integrative Comp Physiol 258: R798-R803, 1990[Abstract/Free Full Text].

23.   Leon, LR, Kozak W, Peschon J, and Kluger MJ. Exacerbated febrile responses to LPS, but not turpentine, in TNF double receptor-knockout mice. Am J Physiol Regulatory Integrative Comp Physiol 272: R563-R569, 1997[Abstract/Free Full Text].

24.   Leon, LR, White AA, and Kluger MJ. Role of IL-6 and TNF in thermoregulation and survival during sepsis in mice. Am J Physiol Regulatory Integrative Comp Physiol 275: R269-R277, 1998[Abstract/Free Full Text].

25.   Michel, O, Duchateau J, and Sergysels R. Effect of inhaled endotoxin on bronchial reactivity in asthmatic and normal subjects. J Appl Physiol 66: 1059-1064, 1989[Abstract/Free Full Text].

26.   Mouihate, A, Chen X, and Pittman QJ. Interleukin-1beta fever in rats: gender difference and estrous cycle influence. Am J Physiol Regulatory Integrative Comp Physiol 275: R1450-R1454, 1998[Abstract/Free Full Text].

27.   Nagata, M, Nakauchi H, Nakayama K, Loh D, and Watanabe T. Apoptosis during an early stage of nephrogenesis induces renal hypoplasia in bcl-2-deficient mice. Am J Pathol 148: 1601-1611, 1996[Abstract].

28.   Ratts, VS, Flaws JA, Kolp R, Sorenson CM, and Tilly JL. Ablation of bcl-2 gene expression decreases the numbers of oocytes and primordial follicles established in the post-natal female mouse gonad. Endocrinology 136: 3665-3668, 1995[Abstract].

29.   Redline, S, and Gold D. Challenges in interpreting gender differences in asthma. Am J Respir Crit Care Med 150: 1219-1221, 1994[Web of Science][Medline].

30.   Reed, JC. Bcl-2 family proteins. Oncogene 17: 3225-3236, 1998[Web of Science][Medline].

31.   Rylander, R. Health effects of cotton dust exposures. Am J Ind Med 17: 39-45, 1990[Web of Science][Medline].

32.   Rylander, R, Bake B, Fischer J, and Helander I. Pulmonary function and symptoms after inhalation of endotoxin. Am Rev Respir Dis 140: 981-986, 1989[Web of Science][Medline].

33.   Schwartz, D, Thorne P, Jagielo P, White G, Bleuer S, and Frees K. Endotoxin responsiveness and grain dust-induced inflammation in the lower respiratory tract. Am J Physiol Lung Cell Mol Physiol 267: L609-L617, 1994[Abstract/Free Full Text].

34.   Schwartz, D, Thorne P, Yagla S, Burmeister L, Olenchock S, Watt J, and Quinn T. The role of endotoxin in grain dust-induced lung disease. Am J Respir Crit Care Med 152: 603-608, 1995[Abstract].

35.   Skobeloff, EM, Spivey WH, St. Clair SS, and Schoffstall JM. The influence of age and sex on asthma admissions. JAMA 268: 3437-3440, 1992[Abstract/Free Full Text].

36.   Sorenson, CM, Rogers SA, Korsmeyer SJ, and Hammerman MR. Fulminant metanephric apoptosis and abnormal kidney development in bcl-2-deficient mice. Am J Physiol Renal Fluid Electrolyte Physiol 268: F73-F81, 1995[Abstract/Free Full Text].

37.   Tesfaigzi, J, Johnson NF, and Lechner JF. Induction of EGF receptor and erbB-2 during endotoxin-induced alveolar type II cell proliferation in the rat lung. Int J Exp Pathol 77: 143-154, 1996[Web of Science][Medline].

38.   Tesfaigzi, J, Smith-Harrison W, and Carlson DM. A simple method for reusing Western blots on PVDF membranes. Biotechniques 17: 268-269, 1994[Web of Science][Medline].

39.   Tesfaigzi, J, Wood MB, Johnson NF, and Nikula KJ. Apoptosis is a major pathway responsible for the resolution of endotoxin-induced type II cell hyperplasia in the rat. Int J Exp Pathol 79: 303-312, 1998[Web of Science][Medline].

40.   Tesfaigzi, Y, Fischer MJ, Martin AJ, and Seagrave J. Bcl-2 in LPS- and allergen-induced hyperplastic mucous cells in airway epithelia of Brown Norway rats. Am J Physiol Lung Cell Mol Physiol 279: L1210-L1217, 2000[Abstract/Free Full Text].

41.   Ulich, T, Watson L, Yin S, Guo K, Wang P, Thang H, and del Castillo J. The intratracheal administration of endotoxin and cytokines. I. Characterization of LPS-induced IL-1 and TNF mRNA expression and the LPS-, IL-1-, and TNF-induced inflammatory infiltrate. Am J Pathol 138: 1485-1496, 1991[Abstract].

42.   Veis, DJ, Sorenson CM, Shutter JR, and Korsmeyer SJ. Bcl-2-deficient mice demonstrate fulminant lymphoid apoptosis, polycystic kidneys, and hypopigmented hair. Cell 75: 229-240, 1993[Web of Science][Medline].

43.   Xing, Z, Gauldie J, Cox G, Baumann H, Jordana M, Lei XF, and Achong MK. IL-6 is an anti-inflammatory cytokine required for controlling local or systemic acute inflammatory responses. J Clin Invest 101: 311-320, 1998[Web of Science][Medline].

44.   Xing, Z, Jordana M, Kirpalani H, Driscoll K, Schall T, and Gauldie J. Cytokine expression by neutrophils and macrophages in vivo: endotoxin induces tumor necrosis factor-alpha , macrophage inflammatory protein-2, interleukin-1beta , and interleukin-6 but not RANTES or transforming growth factor-beta 1 mRNA expression in acute lung inflammation. Am J Respir Cell Mol Biol 10: 148-153, 1994[Abstract]. [Corrigenda. Am J Respir Cell Mol Biol 10: Mar 1994, following p. 346.]

45.   Zemel, BS, Kawchak DA, Cnaan A, Zhao H, Scanlin TF, and Stallings VA. Prospective evaluation of resting energy expenditure, nutritional status, pulmonary function, and genotype in children with cystic fibrosis. Pediatr Res 40: 578-586, 1996[Web of Science][Medline].


J APPL PHYSIOL 91(5):2182-2189
8750-7587/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
BloodHome page
R. A. Dean, J. H. Cox, C. L. Bellac, A. Doucet, A. E. Starr, and C. M. Overall
Macrophage-specific metalloelastase (MMP-12) truncates and inactivates ELR+ CXC chemokines and generates CCL2, -7, -8, and -13 antagonists: potential role of the macrophage in terminating polymorphonuclear leukocyte influx
Blood, October 15, 2008; 112(8): 3455 - 3464.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. A. Carey, J. W. Card, J. W. Voltz, D. R. Germolec, K. S. Korach, and D. C. Zeldin
The impact of sex and sex hormones on lung physiology and disease: lessons from animal studies
Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L272 - L278.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. W. Card, M. A. Carey, J. A. Bradbury, L. M. DeGraff, D. L. Morgan, M. P. Moorman, G. P. Flake, and D. C. Zeldin
Gender Differences in Murine Airway Responsiveness and Lipopolysaccharide-Induced Inflammation
J. Immunol., July 1, 2006; 177(1): 621 - 630.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J. F. Harris, M. J. Fischer, J. R. Hotchkiss, B. P. Monia, S. H. Randell, J. R. Harkema, and Y. Tesfaigzi
Bcl-2 Sustains Increased Mucous and Epithelial Cell Numbers in Metaplastic Airway Epithelium
Am. J. Respir. Crit. Care Med., April 1, 2005; 171(7): 764 - 772.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
B. Burke, A. Pridmore, N. Harraghy, A. Collick, J. Brown, and T. Mitchell
Transgenic Mice Showing Inflammation-Inducible Overexpression of Granulocyte Macrophage Colony-Stimulating Factor
Clin. Vaccine Immunol., May 1, 2004; 11(3): 588 - 598.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tesfaigzi, Y.
Right arrow Articles by Conn, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tesfaigzi, Y.
Right arrow Articles by Conn, C. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online