|
|
||||||||
1 Lovelace Respiratory Research Institute, Albuquerque 87185; and 2 Department of Nutrition, University of New Mexico, Albuquerque, New Mexico 87131
| |
ABSTRACT |
|---|
|
|
|---|
Chronic
pulmonary diseases are more common in boys than in girls. Therefore, we
investigated the differences in signs of sickness in male and female
mice that were exposed to lipopolysaccharide (LPS) by intranasal
instillation. Because apoptosis is important in the resolution
of inflammation, we tested the hypothesis that reduced levels of Bcl-2,
a regulator of apoptosis, may play a role in gender-specific
differences in response to inflammation. Bcl-2 wild-type (+/+) female
mice recovered from an LPS-induced drop in body temperature and loss in
body weight significantly faster than male (+/+) mice. Female
heterozygous (+/
) mice showed reduced Bcl-2 levels and exhibited a
slower recovery than female (+/+) mice that was similar to the recovery
pattern in male (+/+) and (+/
) mice. Interleukin-6 (IL-6) activity
levels in the bronchoalveolar lavage fluid were higher in male than in
female mice but were not different between (+/+) and (+/
) mice. We
conclude that Bcl-2 plays a role in mediating the faster recovery of
female (+/+) mice from LPS-induced signs of sickness independent of
IL-6. These studies indicate that apoptotic mechanisms may be
involved in gender-specific differences in chronic pulmonary diseases.
apoptosis; hypothermia; cytokines; inflammation; mucus
| |
INTRODUCTION |
|---|
|
|
|---|
ASTHMA AND CHILDHOOD WHEEZE are more common and more severe in boys than in girls (29). Between 2 and 14 yr of age, boys are four times more likely to develop chronic asthma than girls (29) and are twice as likely to be hospitalized for asthma (35). Similarly, longitudinal studies in children with cystic fibrosis revealed that pulmonary function is decreased significantly more in boys than in girls (45). These studies suggest a vulnerability of boys to chronic pulmonary inflammation and identify the importance of investigating the cause of gender differences for these diseases.
Airborne endotoxins, lipopolysaccharides (LPS) from the cell walls of gram-negative bacteria, are potent proinflammatory substances that can induce airway obstruction and potentiate the obstructive response to subsequent stimuli (25). Exposure to LPS occurs by inhalation of endotoxin-contaminated water or certain types of organic dusts (2, 11, 32, 34). Exposure of mice to LPS by intranasal or intratracheal instillations has been used as models for inflammatory diseases, such as cystic fibrosis, chronic bronchitis, and pneumonia (10, 40, 41).
Mice injected with LPS, generally used as a model of systemic
inflammatory response syndrome, develop an acute phase response accompanied by sickness symptoms such as hypothermia, fever, anorexia (i.e., decreased food intake), and cachexia (i.e., decreased body weight) (23). Several lines of evidence support the
hypothesis that interleukin (IL)-6 and tumor necrosis factor (TNF)-
play a role in this syndrome (4, 22, 24). Furthermore, LPS
injection causes oligonucleosomal and random DNA fragmentation in
several organs, including the lung (3). Inhibition of
caspase activity in these mice prevents the LPS-induced
apoptosis and acute lung injury (14). Decreased or
suppressed apoptosis of immune effector cells in inflamed
tissues is crucial for the evolution of an inflammatory process in
different organs (43). Furthermore, apoptotic cell death plays a critical role in the clearance of inflamed tissue and
recovery from the inflammatory response (6, 7). It is also
involved in the resolution of LPS-induced alveolar type II cell
hyperplasia (39). The Bcl-2 protein enhances cell survival by inhibiting apoptosis induced under a wide variety of
circumstances in leukocytes and in several epithelial tissues
(30), suggesting that this protein acts at a central
control point in the pathway to apoptotic cell death
(1).
Although the effects of LPS administered by injection have been studied extensively, the effects of LPS exposure through the respiratory tract on body temperature and other inflammatory responses have not been well characterized. We wanted to establish whether there are differences in clinical symptoms between young male and female mice that were exposed to LPS through the respiratory system. Furthermore, we hypothesized that Bcl-2 as a regulator of apoptosis may be involved in the gender-specific differences in LPS-induced inflammatory disease. Therefore, we examined the effects of reduced Bcl-2 levels on LPS-induced inflammatory response and symptoms of illness. We describe differences in the clinical outcomes in male and female mice after intranasal instillation with LPS and demonstrate that even reduced levels of Bcl-2 affect the gender-specific differences in the recovery from LPS-induced physiological and behavioral signs of sickness.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Animals.
Breeder mice heterozygous for the Bcl-2 gene [Bcl-2-(+/
)] were
obtained from Dr. Stanley Korsmeyer (Washington University School of
Medicine, St. Louis, MO) and were bred in our barrier facility. The
generation of Bcl-2 heterozygous mice by gene targeting and the genetic
background of these mice are described elsewhere (42).
Bcl-2 knockout (
/
) mice complete embryonic development but display
early mortality postnatally (42) because of involution of
the thymus and spleen and abnormal morphogenesis of the kidney and
renal failure due to extensive apoptosis (27).
Heterozygous (+/
) mice express less Bcl-2 protein than wild-type
(+/+) animals; however, (+/+) and (+/
) mice show no significant
differences in their development and life span (28, 36).
Therefore, Bcl-2 heterozygous mice were used for the following experiments.
) mice. The primer pair
CTTTGTGGAACTGTACGGCCCCAGCATGCG and ACAGCCTGCAGCTTTGTTTCATGGTACATC was
used to amplify the Bcl-2 gene across the area where the neo gene was
inserted for identification of (+/+) mice. Age- and gender-matched control and Bcl-2 (+/
) littermates were used for each experiment.
Animal care. The Lovelace Respiratory Research Institute's Animal Care and Use Committee approved all care and treatment of the mice. All mice were housed in individual plastic cages and maintained in a temperature-, humidity-, and light-controlled chamber set at 30 ± 1°C, with a 12:12-h light-dark cycle with lights on at 6 AM. Rodent laboratory chow and drinking water were provided ad libitum. Once the mice reached 6-8 wk of age, biotelemetry devices to monitor body temperature and motor activity were implanted under sterile conditions.
Body temperature measurement and locomotor activity.
One week before the start of the experiment, mice were implanted
intraperitoneally with battery-operated biotelemeters (model VMFH,
Mini-Mitter, Sunriver, OR) as described previously (17). Each transmitter was calibrated to ±0.1°C before implantation. Signals from the telemeters were collected by receivers (model RA1010,
Mini-Mitter) placed beneath the floor of each cage. The frequency
emitted by the transmitters is proportional to the abdominal temperature of the mice. Experiments were started after a regular rhythm of body temperature and activity in freely moving mice had been
monitored for
3 days. Motor activity of the mice was measured with
the biotelemetry system described above. Briefly, in this system,
changes in activity are detected by changes in position of the
implanted transmitter over the receiver board. This results in a change
of the signal strength that is detected by the receiver and recorded as
a "pulse" or "count" of activity. As the animal moved freely in
the cage, an activity count was generated whenever the signal strength
received by the antennas was altered more than the previously set limit
for change. These counts were stored per unit time and provided an
index of general locomotor activity. Recordings were made at 5-min
intervals through a peripheral processor (Datacol III System) connected
to an IBM personal computer.
Body weight and intake of food and water. Body weight and food and water intake were monitored daily by weighing each mouse on a top-loading balance accurate to ±0.1 g (Sartorius model MP 1206, Brinkman Instruments, Westbury, NY) between 8 and 10 AM.
LPS instillations. Mice were intranasally instilled with 180 µg of LPS once only, with 60 µg of LPS in 50 µl of saline on 3 consecutive days, or with 50 µl of saline only as a control during a short period of anesthesia. To avoid any circadian variation in body temperature, all instillations were made between 8 and 10 AM.
Necropsy and tissue preparation. Thoracic contents were exposed, and the lungs were perfused through the pulmonary artery with phosphate-buffered saline (Life Technologies, Grand Island, NY). The trachea and lungs were isolated, and each was lavaged three times with 1.5 ml of ice-cold medium 199. The lavage fluid was collected. The lung was expanded to inspiratory volume by intratracheal instillation of 10% zinc formalin (Stephens Scientific, Riverdale, NJ) at 25 cmH2O constant pressure for 3-4 h, as described elsewhere (37). Then the lung was immersed in the same fixative for 3-4 days.
Western blot analysis.
Protein extracts were prepared from the entire right lung or entire
spleen of (+/+) and (+/
) mice by homogenization in RIPA buffer (10 mM
Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% deoxycholate, 0.1%
SDS, and 5 mM EDTA) supplemented with the protease inhibitors phenylmethylsulfonyl fluoride (1 mM), pepstatin (10 µg/ml), aprotinin (2 µg/ml), and benzamidine (2 µg/ml). Protein concentration was determined using the bicinchoninic acid assay kit (Pierce, Rockford, IL); 120 µg of protein from each sample were loaded on each lane. Western blotting was carried out as described earlier
(38), and filters were incubated with antibodies to actin
(Santa Cruz Biotechnology, Santa Cruz, CA) to confirm that equivalent
amounts of protein had been loaded on each lane. The antibodies to
Bcl-2 (Pharmingen, San Diego, CA) and actin were used at 1:1,000 dilution.
Histopathology. The fixed lung was cut into slices, each ~4 mm thick. Three to four slices were prepared, depending on the size of the lung, and slices were embedded in paraffin. Each slice was placed down so that the tissue sections represent the lung sequentially from cranial to caudal when 5-µm sections were prepared from the embedded tissues for staining with alcian blue to detect mucous cells. The number of mucous cells in all airways of the tissues sections was determined by counting all alcian blue-positive cells in the airways of the tissue sections prepared from each lung.
Quantification of neutrophils and macrophages. Cells recovered by lavage of the lungs were enumerated using a hemocytometer. Cytological specimens were prepared and stained with Wright-Giemsa (Fisher Scientific, Pittsburgh, PA) to determine the different types of cells present in the bronchoalveolar lavage fluid (BALF). Four hundred cells were counted from each slide to determine a percent distribution of the different cell types. The total numbers of each cell type were then calculated by multiplying the percentage distribution of the respective cell types by the total cell numbers obtained by lavage.
Bioassays for IL-6 and TNF-
.
IL-6 and TNF bioactivity was measured in the BALF using the
IL-6-dependent B-9 hybridoma cell line and the TNF-sensitive WEHI-164 subclone 13 cell line, essentially as described previously (5, 20). Briefly, the basis for the IL-6 bioassay is that the
hybridoma cells are IL-6 dependent and replicate in direct proportion
to the quantity of IL-6 present (21). The basis of the
bioassay for TNF is that this cytokine is toxic to the fibroblast cell line (5). Cells were resuspended in medium before addition of the lavage samples or known amounts of recombinant cytokines. Triplicate standards and triplicate test samples were incubated with
cells; cell growth was assayed by the addition of
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and
estimated by colorimetric assay. Because we did not neutralize the
activities in the BALF with antibodies to IL-6 or TNF, the measured
activity must be considered "IL-6- or TNF-like."
Data analysis. Three separate experiments were conducted, and combined data are presented as means ± SE. A three-factor ANOVA was used to test for differences among groups for changes in cytokine levels and mucous and inflammatory cell numbers in the BALF. For samples in which the activity of a cytokine was below the level of detection of the appropriate assay, the value zero was used in calculations of group means. Temperature and activity data, collected at 5- to 15-min intervals, were averaged over 12 h and analyzed.
| |
RESULTS |
|---|
|
|
|---|
Changes in body temperature after one high-dose and three low-dose
instillations with LPS.
Although most organisms are primarily exposed to LPS through the
respiratory tract, our understanding of physiological and behavioral
changes after intranasal instillation of LPS in mice is limited.
Undisturbed C57Bl/6 mice kept at an ambient temperature of 30°C on a
12:12-h light-dark cycle revealed a rhythm in body temperature having
two phases: a nighttime rise, then a daytime fall. Intranasal
instillation of 50 µl of saline one or three times on consecutive
days did not disturb the rhythm in body temperature, but the rhythm was
disturbed after a single instillation of 180 µg of LPS in 50 µl of
saline (Fig. 1). The body temperature did not rise during the night and stayed at daytime temperatures during the
ensuing 3-day period. However, three consecutive daily instillations of
60 µg of LPS each caused the body temperature to decrease drastically (Fig. 1B). After the first inoculation, decreases to levels
observed after a one-time instillation of 180 µg of LPS were
observed. The second instillation caused a further decrease of
~0.5°C, and the body temperatures fell by ~2-3°C after the
third LPS instillation. At 3 days after the final instillation, the
body temperature recovered to values comparable to those of mice that
were instilled only once. To maximize clinical symptoms, all further
experiments were carried out by instilling mice on 3 consecutive days
with 60 µg of LPS.
|
Bcl-2 levels in the spleens and lungs from
(+/+) and
(+/
) mice.
The abundance of Bcl-2 was determined in (+/+) and (+/
) mice by
Western blot analysis. In the spleen, Bcl-2 was detected in the (+/+)
and (+/
) mice; however, as previously shown by others (42), Bcl-2 levels in (+/
) mice were about half those in
the wild-type mice, confirming that mice were correctly allelotyped as
Bcl-2 (+/+) and (+/
) mice (Fig. 2). The
actin levels demonstrate that the same amounts of protein from (+/+)
and (+/
) mice were analyzed. Similar results were obtained when Bcl-2
levels were examined in lung extracts (data not shown).
|
Female (+/+) mice recover
faster than female (+/
) mice from
an LPS-induced decrease in body temperature and motor activity.
Male and female Bcl-2 (+/+) and (+/
) mice housed at 30°C on a
12:12-h light-dark cycle displayed a regular rhythm in body temperature. Female mice, regardless of their genotype, had
significantly higher body temperatures before LPS instillation (Fig.
3) and were more active during dark
periods (data not shown) than male mice. Because maximum changes were
observed with three consecutive LPS instillations, this protocol was
used for determining the role of reduced Bcl-2 levels on LPS-induced
changes in body temperature and other physiological end points. Saline
instillations on 3 consecutive days produced no significant difference
in body temperature among groups (Fig. 3A). However, after
three instillations of 60 µg of LPS, the female (+/+) mice recovered
significantly faster from the LPS-induced decrease in body temperature
than the male (+/+) mice (Fig. 3B). Interestingly, the
gender difference in the recovery from LPS-induced reduction in body
temperature was not observed in Bcl-2 (+/
) mice (Fig. 3C).
Male and female (+/
) mice did not differ, and their rates of recovery
were similar to that observed in male (+/+) mice. Furthermore, the
female (+/+) mice recovered significantly faster than the female (+/
)
mice. The difference between male (+/+) and (+/
) mice was not
significant. Similar results were obtained for the activity
measurements in these mice (data not shown).
|
Female (+/+) mice recover
faster than female (+/
) mice from
LPS-induced decrease in body weight.
The weight of the mice in the different groups was not significantly
different from each other 2 days before saline instillation (21.4 to
23.7 g). At 3 days after saline instillation, male mice showed a larger
increase in body weight than female mice, which is consistent with the
faster growth of male mice (Fig.
4A). LPS instillation induced
a significant loss of body weight in all groups (Fig. 4, B
and C). The female (+/+) mice lost significantly less body
weight than the male (+/+) mice and recovered to the original body
weight within 4 days (Fig. 4B). The difference in body
weight between the male and female (+/
) mice was significantly different only at day 1, and both groups of mice did not
recover their original body weight by day 4 after LPS
instillation (Fig. 4C). Similar observations were made for
the LPS-induced decrease in water and food intake, whereby the changes
in water and food intake precede the changes observed in weight changes
(data not shown). Therefore, the LPS-induced weight loss is likely to
be primarily a result of decreased food intake.
|
LPS-induced changes in IL-6 and TNF-
activity in the BALF and
plasma.
IL-6 activity could not be detected in BALF from any of the
saline-instilled mice. However, IL-6 activity in BALF from
LPS-instilled mice was significantly elevated on days 1 and
2 (Fig. 5). Among the
LPS-instilled mice, male mice had significantly higher IL-6 activity in
the BALF than female mice on day 1 after inoculation. In
male and female mice, IL-6 activity had returned to undetectable levels
by day 4. On day 3 after LPS inoculation, male
mice, but not female mice, had significantly elevated levels of IL-6 in the BALF. These results indicate that male mice had a more pronounced IL-6 response in the lung than female mice and were delayed in returning to the normal undetectable levels of IL-6 activity after inoculation compared with female mice. However, there were no significant differences between heterozygous and wild-type mice in BALF
IL-6 activity for any day after inoculation.
|
activity was not elevated in BALF from LPS-instilled mice
compared with saline-instilled mice at any time from day 1 through day 4 after inoculation (data not shown). Neither
IL-6 nor TNF-
activity was significantly elevated in plasma from the saline- or LPS-instilled mice on any day after inoculation (data not shown).
LPS-induced changes in inflammatory cells from the BALF.
Infiltration of the lung by inflammatory cells was analyzed to
determine its association with the observed physiological changes. Mice
instilled with saline had low cell counts in BALF. Only neutrophils and
macrophages were found in significant numbers in BALF from the four
LPS-instilled groups of mice. The numbers of neutrophils were highest
at day 1 after LPS instillation and gradually decreased to
background levels over 4 days (Fig.
6A). No significant
differences could be observed on any day among the four groups treated
with LPS. The numbers of macrophages were significantly elevated
relative to saline groups by day 1, remained elevated over 3 days, and decreased to background levels at day 4 (Fig.
6B). The number of infiltrating lymphocytes was similar to
that observed for macrophages and showed no significant differences
among groups over the 4 days after instillation (data not shown).
Mucous cells in airway epithelia were significantly increased after
LPS, but not saline, instillation on days 3 and 4 after instillation. At days 2, 3, and 4 after LPS
instillation, the numbers of mucous cells were not significantly
different among the four groups of mice (data not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
The major conclusions from this study are that the faster recovery of female (+/+) than male (+/+) mice from LPS-induced signs of sickness is abrogated when Bcl-2 levels are reduced. This effect of Bcl-2 is independent of IL-6 levels and independent of the influx and clearance of inflammatory cells in the lungs.
A single intranasal instillation of 60 or 180 µg of LPS caused similar effects in the decrease in body temperature, indicating that at these high doses the body temperature is not affected in a dose-dependent manner. However, three consecutive instillations of 60 µg of LPS caused a drastic reduction in body temperature, confirming that repeated exposures exacerbate the detrimental effects of environmental toxins (13, 31, 33). The drop in body temperature was not followed by fever, as was observed for LPS injected intraperitoneally (15, 23), indicating a difference in the inflammatory response depending on the route of LPS administration. Intranasal inoculation of mice with influenza virus causes decreased body temperature, general locomotor activity, and food and water intake (5, 16). The similarity in the effects of LPS or viral DNA administered through the respiratory tract suggests that the localization of the inflammatory response may be critical in the observed physiological changes. Influenza pneumonitis in mice is associated with a dose-dependent decrease in blood oxygen saturation (16). Hypoxia itself can induce production of cytokines, including IL-6 (9), depress metabolism, and decrease body temperature. Therefore, one mechanism underlying the intranasal instillation of LPS-induced hypothermia may also involve pneumonitis-induced hypoxia.
All groups of mice showed increased neutrophils, macrophages, and
lymphocytes in the BALF followed by increased mucous cell numbers over
the 4 days after LPS instillation. However, the numbers of these
inflammatory indicators were not statistically different among genders
and/or genotypes, suggesting that Bcl-2 levels in (+/
) mice were
sufficient for inflammatory cell migration and clearance and the
development of mucous cell metaplasia in the lung airways.
The female (+/+) mice recovered significantly faster than the male
(+/+) mice from hypothermia, cachexia, and anorexia after three
intranasal instillations of LPS. Immune activation, which results in
cytokine production, is modulated by circulating hormones, such as
glucocorticoids and gonadal hormones (18). There is evidence that spleen cells from female mice have altered immune responses compared with those from male mice, which may be mediated by
gender-specific hormones (18). Another study suggests that female mice eliminate the Coxsackie B-3 virus faster than male mice
(12). Therefore, the faster recovery of female mice in the
present study may be due to a faster development of tolerance to LPS or
to an enhanced clearance of LPS by phagocytic cells. Immune responses
change during the estrous cycle in rodents (19). Fever
induced by IL-1
injection in rats was significantly higher and more
prolonged in females at proestrus than at diestrus (26). In the present study, mice were not selected for the different stages
of the estrous cycle; however, the faster recovery of female mice from
the LPS-induced decrease in body temperature was consistent in three
different experiments. The data presented in this study are combined
from three independent experiments balanced for all experimental groups
in which each replication consistently showed a difference in the
female wild-type mice. These results suggest that female mice recover
faster than male mice regardless of their stage in the estrous cycle or
that the effect of the different stages was not diluted by female mice
in the inactive stages of the cycle.
The female (+/+) mice recovered significantly faster than the female
(+/
) and male mice from the LPS-induced signs of sickness. However,
the rate of recovery of female and male (+/
) mice was statistically
not significantly different, suggesting that mice with reduced levels
of Bcl-2 do not show the gender-specific difference in recovery.
Furthermore, this result implies that the immune system of female (+/+)
mice responds in a manner similar to that of male (+/+) mice when Bcl-2
levels are reduced.
Our data and many other studies implicate IL-6 as one of the cytokines
involved in the observed LPS-induced inflammatory responses. It is well
established that IL-6 levels increase drastically after LPS exposure in
several species (20, 44). In this study, male (+/+) mice
had higher levels of IL-6 at day 1 after LPS instillation than female (+/+) mice. The inflammatory response comprises many aspects. Although male mice did not have a higher influx of
neutrophils, one indicator of an inflammatory response, the increased
IL-6 levels in male mice compared with female mice, indicates that male
mice had a higher inflammatory response to LPS instillation. Similarly,
significantly increased plasma IL-6 concentrations were also found in
male but not in female mice that were subjected to hypoxemia
(14a). By day 3 after LPS instillation, IL-6
activity in the BALF from female mice had already returned to
undetectable levels, whereas IL-6 activity from male mice remained
significantly elevated. This difference in cytokine activity levels in
the BALF correlates with the faster recovery of female (+/+) mice from symptoms of illness. IL-6 appears to be involved in the LPS-induced clinical symptoms; however, no significant differences in IL-6 levels
were observed between the female (+/+) and (+/
) mice at this or any
time point analyzed. This observation suggests that the lower levels of
Bcl-2 in heterozygotes are still sufficient to elicit a female IL-6
response and that Bcl-2 is not acting through IL-6 in its role to
mediate the faster recovery of female (+/+) mice than the other groups
of mice from LPS-induced inflammation. TNF-
levels are known to
increase at early time points (2 h) post-LPS exposure and decrease
to background levels after 6 h (13a). In this study,
the measurements were done in the BALF obtained 24 h postinoculation,
by which time TNF-
levels may have been reduced to undetectable levels.
Hormones modulate expression of apoptotic factors in lymphoid cell death, and Bcl-2 is upregulated by estrogen in several tissues (8). Inflammatory cell numbers in the BALF were not different among all LPS-treated groups, indicating that the clearance of inflammatory cells is not affected by decreased Bcl-2 levels. However, it is possible that reduced levels of Bcl-2 expression in heterozygous female mice inactivate the estrogen-dependent immune response of certain leukocytes to LPS. Because Bcl-2 is modulated by estradiol in some brain neurons (8), it is also possible that Bcl-2 levels have a direct effect on thermoregulatory or appetite centers in the brain. Further research is warranted to determine whether certain cells have reduced Bcl-2 levels in male compared with female mice and to identify the mechanisms by which Bcl-2 mediates the faster recovery in female mice. These studies are crucial to understand the molecular basis of sex-specific differences in chronic pulmonary diseases.
| |
ACKNOWLEDGEMENTS |
|---|
The authors thank Yoneko Knighton for preparation of tissue samples and Dr. Margaret Ménache for valuable advice on solving the statistical problems.
| |
FOOTNOTES |
|---|
Lovelace Respiratory Research Institute is fully accredited by the International Association for the Assessment and Accreditation of Laboratory Animal Care.
These studies were sponsored by grants from the American Lung Association and National Institute of Environmental Health Sciences Grant ES-09237 (Y. Tesfaigzi).
Address for reprint requests and other correspondence: Y. Tesfaigzi, Lovelace Respiratory Research Institute, 2425 Ridgecrest Dr., Albuquerque, NM 87108 (E-mail: ytesfaig{at}lrri.org).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 23 March 2001; accepted in final form 28 June 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Adams, JM,
and
Cory S.
The Bcl-2 protein family: arbiters of cell survival.
Science
281:
1322-1326,
1998
2.
Blaski, C,
Clapp W,
Thorne P,
Quinn T,
Watt J,
Fress K,
Yagla S,
and
Schwartz D.
The role of atopy in grain dust-induced airway disease.
Am J Respir Crit Care Med
154:
334-340,
1996[Abstract].
3.
Bohlinger, I,
Leist M,
Gantner F,
Angermuller S,
Tiegs G,
and
Wendel A.
DNA fragmentation in mouse organs during endotoxic shock.
Am J Pathol
149:
1381-1393,
1996[Abstract].
4.
Chai, Z,
Gatti S,
Toniatti C,
Poli V,
and
Bartfai T.
Interleukin (IL)-6 gene expression in the central nervous system is necessary for fever response to lipopolysaccharide or IL-1
: a study on IL-6-deficient mice.
J Exp Med
183:
311-316,
1996
5.
Conn, C,
McClellan J,
Maassab H,
Smitka C,
Majde J,
and
Kluger M.
Cytokines and the acute phase response to influenza virus in mice.
Am J Physiol Regulatory Integrative Comp Physiol
268:
R78-R84,
1995
6.
Cox, G,
Crossley J,
and
Xing Z.
Macrophage engulfment of apoptotic neutrophils contributes to the resolution of acute pulmonary inflammation in vivo.
Am J Respir Cell Mol Biol
12:
232-237,
1995[Abstract].
7.
Coxon, A,
Rieu P,
Barkalow FJ,
Askari S,
Sharpe AH,
von Andrian UH,
Arnaout MA,
and
Mayadas TN.
A novel role for the
2-integrin CD11b/CD18 in neutrophil apoptosis: a homeostatic mechanism in inflammation.
Immunity
5:
653-666,
1996[Web of Science][Medline].
8.
Garcia-Segura, LM,
Cardona-Gomez P,
Naftolin F,
and
Chowen JA.
Estradiol upregulates Bcl-2 expression in adult brain neurons.
Neuroreport
9:
593-597,
1998[Web of Science][Medline].
9.
Ghezzi, P,
Dinarello CA,
Bianchi M,
Rosandich ME,
Repine JE,
and
White CW.
Hypoxia increases production of interleukin-1 and tumor necrosis factor by human mononuclear cells.
Cytokine
3:
189-194,
1991[Web of Science][Medline].
10.
Harkema, JR,
and
Hotchkiss JA.
In vivo effects of endotoxin on intraepithelial mucosubstances in rat pulmonary airways. Quantitative histochemistry.
Am J Pathol
141:
307-317,
1992[Abstract].
11.
Harkema, JR,
and
Hotchkiss JA.
Ozone- and endotoxin-induced mucous cell metaplasias in rat airway epithelium: novel animal models to study toxicant-induced epithelial transformation in airways.
Toxicol Lett
68:
251-263,
1993[Web of Science][Medline].
12.
Huber, SA,
Job LP,
and
Auld KR.
Influence of sex hormones on Coxsackie B-3 virus infection in Balb/c mice.
Cell Immunol
67:
173-179,
1982[Web of Science][Medline].
13.
Jagielo, P,
Thorne P,
Kern J,
Quinn T,
and
Schwartz D.
Role of endotoxin in grain dust-induced lung inflammation in mice.
Am J Physiol Lung Cell Mol Physiol
270:
L1052-L1059,
1996
13a.
Johnston, CJ,
Finkelstein JN,
Gelein R,
and
Oberdorster G.
Pulmonary cytokine and chemokine mRNA levels after inhalation of lipopolysaccharide in C57BL/6 mice.
Toxicol Sci
46:
300-307,
1998
14.
Kawasaki, M,
Kuwano K,
Hagimoto N,
Matsuba T,
Kunitake R,
Tanaka T,
Maeyama T,
and
Hara N.
Protection from lethal apoptosis in lipopolysaccharide-induced acute lung injury in mice by a caspase inhibitor.
Am J Pathol
157:
597-603,
2000
14a.
Knoferl, MW,
Jarrar D,
Schwacha MG,
Angele MK,
Cioffi WG,
Bland KI,
and
Chaudry IH.
Severe hypoxemia in the absence of blood loss causes a gender dimorphic immune response.
Am J Physiol Cell Physiol
279:
C2004-C2010,
2000
15.
Kozak, W,
Kluger MJ,
Soszynski D,
Conn CA,
Rudolph K,
Leon LR,
and
Zheng H.
IL-6 and IL-1
in fever. Studies using cytokine-deficient (knockout) mice.
Ann NY Acad Sci
856:
33-47,
1998[Web of Science][Medline].
16.
Kozak, W,
Poli V,
Soszynski D,
Conn CA,
Leon LR,
and
Kluger MJ.
Sickness behavior in mice deficient in interleukin-6 during turpentine abscess and influenza pneumonitis.
Am J Physiol Regulatory Integrative Comp Physiol
272:
R621-R630,
1997
17.
Kozak, W,
Zheng H,
Conn CA,
Soszynski D,
van der Ploeg LH,
and
Kluger MJ.
Thermal and behavioral effects of lipopolysaccharide and influenza in interleukin-1
-deficient mice.
Am J Physiol Regulatory Integrative Comp Physiol
269:
R969-R977,
1995
18.
Krzych, U,
Strausser HR,
Bressler JP,
and
Goldstein AL.
Effects of sex hormones on some T and B cell functions, evidenced by differential immune expression between male and female mice and cyclic pattern of immune responsiveness during the estrous cycle in female mice.
Am J Reprod Immunol
1:
73-77,
1981.
19.
Krzych, U,
Strausser HR,
Bressler JP,
and
Goldstein AL.
Quantitative differences in immune responses during the various stages of the estrous cycle in female BALB/c mice.
J Immunol
121:
1603-1605,
1978
20.
LeMay, DR,
LeMay LG,
Kluger MJ,
and
D'Alecy LG.
Plasma profiles of IL-6 and TNF with fever-inducing doses of lipopolysaccharide in dogs.
Am J Physiol Regulatory Integrative Comp Physiol
259:
R126-R132,
1990
21.
LeMay, LG,
Otterness IG,
Vander AJ,
and
Kluger MJ.
In vivo evidence that the rise in plasma IL-6 following injection of a fever-inducing dose of LPS is mediated by IL-1
.
Cytokine
2:
199-204,
1990[Medline].
22.
LeMay, LG,
Vander AJ,
and
Kluger MJ.
Role of interleukin 6 in fever in rats.
Am J Physiol Regulatory Integrative Comp Physiol
258:
R798-R803,
1990
23.
Leon, LR,
Kozak W,
Peschon J,
and
Kluger MJ.
Exacerbated febrile responses to LPS, but not turpentine, in TNF double receptor-knockout mice.
Am J Physiol Regulatory Integrative Comp Physiol
272:
R563-R569,
1997
24.
Leon, LR,
White AA,
and
Kluger MJ.
Role of IL-6 and TNF in thermoregulation and survival during sepsis in mice.
Am J Physiol Regulatory Integrative Comp Physiol
275:
R269-R277,
1998
25.
Michel, O,
Duchateau J,
and
Sergysels R.
Effect of inhaled endotoxin on bronchial reactivity in asthmatic and normal subjects.
J Appl Physiol
66:
1059-1064,
1989
26.
Mouihate, A,
Chen X,
and
Pittman QJ.
Interleukin-1
fever in rats: gender difference and estrous cycle influence.
Am J Physiol Regulatory Integrative Comp Physiol
275:
R1450-R1454,
1998
27.
Nagata, M,
Nakauchi H,
Nakayama K,
Loh D,
and
Watanabe T.
Apoptosis during an early stage of nephrogenesis induces renal hypoplasia in bcl-2-deficient mice.
Am J Pathol
148:
1601-1611,
1996[Abstract].
28.
Ratts, VS,
Flaws JA,
Kolp R,
Sorenson CM,
and
Tilly JL.
Ablation of bcl-2 gene expression decreases the numbers of oocytes and primordial follicles established in the post-natal female mouse gonad.
Endocrinology
136:
3665-3668,
1995[Abstract].
29.
Redline, S,
and
Gold D.
Challenges in interpreting gender differences in asthma.
Am J Respir Crit Care Med
150:
1219-1221,
1994[Web of Science][Medline].
30.
Reed, JC.
Bcl-2 family proteins.
Oncogene
17:
3225-3236,
1998[Web of Science][Medline].
31.
Rylander, R.
Health effects of cotton dust exposures.
Am J Ind Med
17:
39-45,
1990[Web of Science][Medline].
32.
Rylander, R,
Bake B,
Fischer J,
and
Helander I.
Pulmonary function and symptoms after inhalation of endotoxin.
Am Rev Respir Dis
140:
981-986,
1989[Web of Science][Medline].
33.
Schwartz, D,
Thorne P,
Jagielo P,
White G,
Bleuer S,
and
Frees K.
Endotoxin responsiveness and grain dust-induced inflammation in the lower respiratory tract.
Am J Physiol Lung Cell Mol Physiol
267:
L609-L617,
1994
34.
Schwartz, D,
Thorne P,
Yagla S,
Burmeister L,
Olenchock S,
Watt J,
and
Quinn T.
The role of endotoxin in grain dust-induced lung disease.
Am J Respir Crit Care Med
152:
603-608,
1995[Abstract].
35.
Skobeloff, EM,
Spivey WH,
St. Clair SS,
and
Schoffstall JM.
The influence of age and sex on asthma admissions.
JAMA
268:
3437-3440,
1992
36.
Sorenson, CM,
Rogers SA,
Korsmeyer SJ,
and
Hammerman MR.
Fulminant metanephric apoptosis and abnormal kidney development in bcl-2-deficient mice.
Am J Physiol Renal Fluid Electrolyte Physiol
268:
F73-F81,
1995
37.
Tesfaigzi, J,
Johnson NF,
and
Lechner JF.
Induction of EGF receptor and erbB-2 during endotoxin-induced alveolar type II cell proliferation in the rat lung.
Int J Exp Pathol
77:
143-154,
1996[Web of Science][Medline].
38.
Tesfaigzi, J,
Smith-Harrison W,
and
Carlson DM.
A simple method for reusing Western blots on PVDF membranes.
Biotechniques
17:
268-269,
1994[Web of Science][Medline].
39.
Tesfaigzi, J,
Wood MB,
Johnson NF,
and
Nikula KJ.
Apoptosis is a major pathway responsible for the resolution of endotoxin-induced type II cell hyperplasia in the rat.
Int J Exp Pathol
79:
303-312,
1998[Web of Science][Medline].
40.
Tesfaigzi, Y,
Fischer MJ,
Martin AJ,
and
Seagrave J.
Bcl-2 in LPS- and allergen-induced hyperplastic mucous cells in airway epithelia of Brown Norway rats.
Am J Physiol Lung Cell Mol Physiol
279:
L1210-L1217,
2000
41.
Ulich, T,
Watson L,
Yin S,
Guo K,
Wang P,
Thang H,
and
del Castillo J.
The intratracheal administration of endotoxin and cytokines. I. Characterization of LPS-induced IL-1 and TNF mRNA expression and the LPS-, IL-1-, and TNF-induced inflammatory infiltrate.
Am J Pathol
138:
1485-1496,
1991[Abstract].
42.
Veis, DJ,
Sorenson CM,
Shutter JR,
and
Korsmeyer SJ.
Bcl-2-deficient mice demonstrate fulminant lymphoid apoptosis, polycystic kidneys, and hypopigmented hair.
Cell
75:
229-240,
1993[Web of Science][Medline].
43.
Xing, Z,
Gauldie J,
Cox G,
Baumann H,
Jordana M,
Lei XF,
and
Achong MK.
IL-6 is an anti-inflammatory cytokine required for controlling local or systemic acute inflammatory responses.
J Clin Invest
101:
311-320,
1998[Web of Science][Medline].
44.
Xing, Z,
Jordana M,
Kirpalani H,
Driscoll K,
Schall T,
and
Gauldie J.
Cytokine expression by neutrophils and macrophages in vivo: endotoxin induces tumor necrosis factor-
, macrophage inflammatory protein-2, interleukin-1
, and interleukin-6 but not RANTES or transforming growth factor-
1 mRNA expression in acute lung inflammation.
Am J Respir Cell Mol Biol
10:
148-153,
1994[Abstract]. [Corrigenda. Am J Respir Cell Mol Biol 10: Mar 1994, following p. 346.]
45.
Zemel, BS,
Kawchak DA,
Cnaan A,
Zhao H,
Scanlin TF,
and
Stallings VA.
Prospective evaluation of resting energy expenditure, nutritional status, pulmonary function, and genotype in children with cystic fibrosis.
Pediatr Res
40:
578-586,
1996[Web of Science][Medline].
This article has been cited by other articles:
![]() |
J. W. Card and D. C. Zeldin Hormonal Influences on Lung Function and Response to Environmental Agents: Lessons from Animal Models of Respiratory Disease Proceedings of the ATS, December 1, 2009; 6(7): 588 - 595. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Dean, J. H. Cox, C. L. Bellac, A. Doucet, A. E. Starr, and C. M. Overall Macrophage-specific metalloelastase (MMP-12) truncates and inactivates ELR+ CXC chemokines and generates CCL2, -7, -8, and -13 antagonists: potential role of the macrophage in terminating polymorphonuclear leukocyte influx Blood, October 15, 2008; 112(8): 3455 - 3464. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Carey, J. W. Card, J. W. Voltz, D. R. Germolec, K. S. Korach, and D. C. Zeldin The impact of sex and sex hormones on lung physiology and disease: lessons from animal studies Am J Physiol Lung Cell Mol Physiol, August 1, 2007; 293(2): L272 - L278. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Card, M. A. Carey, J. A. Bradbury, L. M. DeGraff, D. L. Morgan, M. P. Moorman, G. P. Flake, and D. C. Zeldin Gender Differences in Murine Airway Responsiveness and Lipopolysaccharide-Induced Inflammation J. Immunol., July 1, 2006; 177(1): 621 - 630. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Harris, M. J. Fischer, J. R. Hotchkiss, B. P. Monia, S. H. Randell, J. R. Harkema, and Y. Tesfaigzi Bcl-2 Sustains Increased Mucous and Epithelial Cell Numbers in Metaplastic Airway Epithelium Am. J. Respir. Crit. Care Med., April 1, 2005; 171(7): 764 - 772. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Burke, A. Pridmore, N. Harraghy, A. Collick, J. Brown, and T. Mitchell Transgenic Mice Showing Inflammation-Inducible Overexpression of Granulocyte Macrophage Colony-Stimulating Factor Clin. Vaccine Immunol., May 1, 2004; 11(3): 588 - 598. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |