|
|
||||||||
1 Department of Biochemistry, Brody School of Medicine, East Carolina University, Greenville, North Carolina 27858; 2 Department of Biochemistry and Molecular Biology, University of Oklahoma Health Science Center, Oklahoma City, Oklahoma 73190; and 3 Department of Zoology, Brigham Young University, Provo, Utah 84602
| |
ABSTRACT |
|---|
|
|
|---|
Skeletal muscle GLUT-4 transcription in response to
treatment with
5-aminoimidazole-4-carboxamide-1-
-D-ribofuranoside
(AICAR), a known activator of AMP-activated protein kinase (AMPK), was studied in rats and mice. The increase in GLUT-4 mRNA levels in response to a single subcutaneous injection of AICAR, peaked at 13 h in white and red quadriceps muscles but not in the soleus muscle. The
mRNA level of chloramphenicol acyltransferase reporter gene which is
driven by 1,154 or 895 bp of the human GLUT-4 proximal promoter was
increased in AICAR-treated transgenic mice, demonstrating the
transcriptional upregulation of the GLUT-4 gene by AICAR. However, this
induction of transcription was not apparent with 730 bp of the
promoter. In addition, nuclear extracts from AICAR-treated mice bound
to the consensus sequence of myocyte enhancer factor-2 (from
473 to
464) to a greater extent than from saline-injected mice. Thus
AMP-activated protein kinase activation by AICAR increases GLUT-4
transcription by a mechanism that requires response elements within 895 bp of human GLUT-4 proximal promoter and that may be cooperatively
mediated by myocyte enhancer factor-2.
myocyte enhancer factor-2; GLUT-4 promoter; transgenic mice; muscle fiber type
| |
INTRODUCTION |
|---|
|
|
|---|
SKELETAL MUSCLE IS THE MAIN site of postprandial glucose disposal and, thus, plays an important role in glucose homeostasis (5). Several lines of evidence indicate that the amount of GLUT-4 glucose transporter protein in skeletal muscle is an important determinant of maximal glucose transport (9, 11, 15, 16, 18, 24, 40, 42). These studies demonstrated that the level of expression of GLUT-4 in muscle is important for the regulation of glucose homeostasis and that pharmacological intervention of muscle GLUT-4 expression might be a method to treat disease states such as diabetes (52).
Physical activity has been a primary therapeutic regimen used to treat
diabetes and insulin-resistance-associated diseases. Our laboratory and
others have shown that exercise increases the amount of GLUT-4 mRNA and
protein in skeletal muscle (4, 8, 10, 30). Designing
pharmacological interventions that mimic exercise-induced GLUT-4
expression requires a fundamental knowledge of the mechanism that
mediates this effect. There is considerable evidence to suggest that
this mechanism involves the activation of 5'-AMP activated protein
kinase (AMPK). AMPK is activated in response to exercise and electrical
stimulation (17, 45, 49). Furthermore, AMPK activity has
been found to be dependent on two metabolic ratios, AMP/ATP and
creatine/phosphocreatine, both of which increase during exercise
(50). Artificially altering either ratio in intact muscle
has resulted in a predictable effect on GLUT-4 protein levels. Chronic
treatment with
5'-aminoimidazole-4-carboxamide-1-
-D-ribofuranoside (AICAR), an analog of adenosine, leads to high intramuscular levels of
the AMP analog
5-aminoimidazole-4-carboxamide-1-
-D-ribofuranosyl-5'-monophosphophate (ZMP), increased AMPK activity, and increased GLUT-4 protein levels (13, 14, 27, 31). In a similar fashion, chronic treatment of rats with
-guanidinopropionic acid (an analog of creatine) leads
to creatine phosphate depletion and increased GLUT-4 expression in
muscle (35). How, then, does increased AMPK activity lead to increased GLUT-4 protein levels?
In addition to the well-characterized short-term regulatory role in
glucose and fatty acid metabolism (12, 21, 50), there is
growing evidence that AMPK is involved in regulating gene
transcription. The yeast homolog to AMPK, SNF1, plays an important role
in regulating glucose-inducible genes (3, 28). In
mammalian models, it has been shown that the
2 catalytic
subunit of AMPK is preferentially targeted to the nucleus
(38) and that AMPK inhibits the glucose-induced
transcription of L-pyruvate kinase, spot 14, and fatty acid
synthase genes (7, 23). We hypothesized that the
activation of AMPK may lead to increased GLUT-4 protein levels by
stimulating the transcription of the GLUT-4 gene.
To identify the regulatory elements in GLUT-4 proximal promoter,
previous studies showed that myocyte enhancer factor-2 (MEF-2) binding
site, located from
473 to
464 on human GLUT-4 proximal promoter, is
necessary but not sufficient for human GLUT-4 promoter transcriptional
activity (41). A second regulatory element (domain I, from
742 to
712 on human GLUT-4 proximal promoter) has been identified,
which functions cooperatively with MEF-2 domain in regulating
human GLUT-4 transcription (33). Human GLUT-4 promoter transgenic studies have shown that a deletion of either the 30-bp domain I or mutation of the MEF-2 binding domain, within the context of
the 895-hG4-CAT parental promoter construct, completely abolishes transgenics expression (33, 41). MEF-2 DNA binding
activity was substantially reduced in nuclear extracts isolated from
both heart and skeletal muscle of streptozotocin (STZ)-induced
diabetic mice and completely recovered after insulin treatment, which
correlated with transcriptional rate change of GLUT-4 gene
(41).
The purpose of this study was to investigate the role of AMPK in
regulating the transcription of the GLUT-4 gene. First, we determined
the effects of an injection of AICAR on GLUT-4 mRNA levels,
characterizing the time course and fiber type specificity of the
response. To confirm that the increase in GLUT-4 mRNA that we observed
was a result of transcriptional activation, we examined the effect of
an AICAR injection on the expression of a chloramphenicol acyltransferase (CAT) reporter gene driven by 1,154 bp of the human
GLUT-4 promoter. After observing the induction of the reporter gene in
concert with the endogenous GLUT-4 gene, we repeated the experiment in
other transgenic models in which the reporter gene was driven by 895 or
730 bp of the human GLUT-4 proximal promoter (Fig.
1) to identify those regions involved in
AICAR-induced transcriptional activation. The shortest transgenic
construct (730) contains a fully functional MEF-2 site
(
473 to
464) and a truncated domain I (
742 to
712) and supports
a high level of transgene expression in muscle. Finally, we examined
the DNA binding of nuclear extracts from AICAR-injected rats and mice
to consensus sequences of MEF-2 and domain I, two binding sites
implicated in the transcriptional regulation of the GLUT-4 gene
(33, 41). The results of this study show that
1) increasing AMPK activity with a single injection of AICAR
leads to the transcriptional activation of the GLUT-4 promoter,
2) this effect is mediated by response elements that lie
within 895 bp of the promoter, and 3) this effect may be
cooperatively mediated by MEF-2 through increased DNA binding activity.
|
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Animals/experimental protocols. All procedures were approved by the Institutional Animal Care and Use Committees of East Carolina University and Brigham Young University. Male Sprague-Dawley rats (Harlan, Indianapolis, IN) were housed individually with room temperature and lighting controlled (20-22°C; 12:12-h light-dark cycle) and free access to food and water.
To determine the time course of the effect on GLUT-4 mRNA level in muscle from a single AICAR injection, rats were injected subcutaneously with AICAR (1.0 mg/g body wt) or saline as previously described (14). AICAR was dissolved in 50 mg/ml saline. Injection time was 2 h after the start of the dark cycle, and animals had free access to food and water. Either 7, 13, 16, or 24 h after injection, rats were anesthetized by intravenous injection of pentobarbital sodium. Our preliminary observations indicated that AICAR had no effect on GLUT-4 or mRNA 2 and 4 h after injection (data not shown). Gastrocnemius muscles were quickly removed and frozen in liquid nitrogen for later analysis. To determine the acute effect of AICAR injection on GLUT-4 mRNA level in different muscle fiber types, rats were given a single dose of AICAR (1.0 mg/g body wt) or saline. Sixteen hours after injection, rats were anesthetized by intravenous injection of pentobarbital sodium. The superficial white and the deep red regions of the quadriceps muscles and the soleus muscles were quickly removed and frozen in liquid nitrogen for later analysis. To determine the chronic effect of AICAR injection on GLUT-4 protein level in different fiber type muscles, rats were given AICAR or saline injections according to the following schedule: 3 days injected, 2 days not injected, 5 days injected, 2 days not injected, 3 days injected. Rats were killed 24 h after the last injection. This intermittent injection schedule was used to minimize desensitization of AMPK responses to AICAR (51). The superficial white and the deep red regions of the quadriceps muscles and the soleus muscles were quickly removed and frozen in liquid nitrogen for later analysis. Six- to eight-week-old mice were housed with room temperature and lighting controlled (20-22°C; 12:12-h light-dark cycle) and free access to food and water. Transgenic mice were generated as previously described (25, 41), with each transgene containing a portion of the 5' flanking region of the human GLUT-4 gene driving the expression of the bacterial CAT reporter gene. Transgenic mice contained either 1,154 bp (1154-hG4-CAT), 895 bp (895-hG4-CAT), or 730 bp (730-hG4-CAT) of the 5' flanking region to drive the expression of transgene CAT (Fig. 1). Although single transgenic lines for each construct were used in this study, they have been characterized with a high degree of tissue specificity and appropriate hormonal/metabolic regulation (32, 33, 41). Transgenic mice were identified by slot blot analysis of isolated tail DNA, as previously described (25). To ensure that experiments were performed with the same genetic background, we chose to use experimental animals that were offspring of a cross between transgenic mice and wild-type mice (C57bl/6J). Male mice that were heterozygous for the transgenic allele were used in studies of the human GLUT-4 promoter, whereas nontransgenic males were used for control groups and studies on murine GLUT-4 expression and electrophoretic mobility shift assays. To determine the acute effect of the AICAR injection on ZMP concentration and AMPK activity, mice were injected intraperitoneally (IP) with AICAR (1.0 mg/g body wt) or saline, and the same injection protocol was used as in the rat experiments described above. One hour after the injection, gastrocnemius muscles were quickly removed and frozen in liquid nitrogen for later analysis. To investigate the effect of AICAR treatment on GLUT-4 and CAT mRNA, mice were killed 12 h after a single IP injection of AICAR (1.0 mg/g body wt). The gastrocnemius muscles were quickly removed and frozen in liquid nitrogen for later analysis. Random samples of blood were collected from mice to check the blood glucose and lactate concentration using a Yellow Springs Instruments glucose/lactate analyzer (Yellow Springs, OH). Glucose and lactate levels were within physiological range, and no difference was found between control and AICAR group 12 h after a single AICAR injection (data not shown).RNA isolation and Northern analysis.
RNA was isolated from quick frozen muscle samples using the TRIzol
(Life Technologies, Rockville, MD) reagent according to manufacturer's
instructions, as our laboratory has previously described
(19). For Northern analyses, 5 µg of total RNA per samples were fractionated on a 1.25% agarose-2 M formaldehyde gel and
then electrotransfered to a Hybond N+ membrane (Amersham, Piscataway,
NJ). The membrane blots were cross-linked under ultraviolet light for
90 s and prehybridized with ULTRAhyb buffer (Ambion, Austin, TX)
for 1 h at 42°C. Blots were then hybridized overnight at 45°C
with random primed [
-32P]dATP-labeled cDNA probes for
GLUT-4 and then hybridized sequentially with glyceraldehyde 3-phosphate
dehydrogenase (GAPDH) and 18S ribosomal RNA after stripping and
prehybridization. The random primed [
-32P]dATP-labeled
cDNA probes were synthesized with Strip-EZ DNA kit (Ambion) and
purified with a G-50 Nick column (Amersham). Northern blots were
visualized by PhosphorImager and quantitated with Imagequant software
(Molecular Dynamics, Sunnyvale, CA).
RNase protection assays.
Radiolabeled ([
-32P]UTP, 800 Ci/mmol) antisense RNA
probes were transcribed from the pTRI-GAPDH-mouse antisense control
template (Ambion) and the Bsu 361 linearized mouse
GLUT-4-CAT plasmid, p469GLUT-4-CAT (32), using Ambion's
T3/T7 MAXIscript in vitro transcription kit. Briefly, RNase protection
assays (RPA) were performed with the streamlined procedure of Ambion's
RPA II kit as previously described (19, 20). Ten
micrograms total RNA per samples and 32P-labeled antisense
probes were hybridized overnight at 45°C. Nonhybridized RNA was
digested for 1 h at 37°C with 1:1,000 dilution of RNase T1/A
from RPA II kit. The protected RNA fragments were separated by using
6% acrylamide 7.5 M urea gel electrophoresis and were then exposed to
PhosphorImager and quantitated with Imagequant software (Molecular
Dynamics). The size of the protected fragments was estimated by RNA
transcripts labeled with [
-32P]UTP from Century Marker
Templates (Ambion) by using T7 RNA polymerase.
Analysis of AMP kinase activity and ZMP.
Muscles from mice killed 1 h after injection of AICAR or saline
were analyzed for ZMP and AMPK (27, 49). Muscles were kept
under liquid nitrogen until they were analyzed. They were first ground
to powder under liquid nitrogen. Perchloric acid extracts (400 mg of
tissue powder added to 2.0 ml of 6% perchloric acid) were prepared,
and a 1-ml aliquot of the 6% perchloric acid extract was vortexed
vigorously with 1 ml of
1,1,2-trichlorotrifluoroethane:tri-n-octylamine (1:1) to
remove the perchloric acid. After centrifugation, the supernatant was
stored at
70°C until analysis. ZMP was determined by using a
Beckman HPLC system (supported by System Gold software) by a
modification of the method described by Sabina et al.
(37). Briefly, we used a Hichrom P10SAX column (0.45 × 25 cm) (DyChrom, Santa Clara, CA) with a P10SAX-10C5 guard column.
At a flow rate of 2 ml/min, the elution began with 100% buffer
A (5 mM NH4H2PO4, pH 2.8) and
0% buffer B (750 mM
NH4H2PO4, pH 3.9). Buffer
B was increased linearly to 9.3% over a 14-min period. Then over
the next 36 min buffer B was increased to 100% in a linear
gradient. AMPK activity was determined by using ammonium sulfate
precipitates from homogenates prepared from the powdered (under liquid
nitrogen) muscles as described previously (49).
Western immunoblot. Muscles from rats killed 22-25 h after the tenth AICAR injection were analyzed for GLUT-4 protein content. Muscle samples were ground to powder under liquid nitrogen. A homogenate (1:9 dilution) was prepared in HEPES buffer [25 mM HEPES, 1 mM EDTA, 1 mM benzamidine, 1 mM 4-(2-aminoethyl)-benzene + sulfonyl fluoride, 1 µM leupeptin, 1 µM pepstatin, 1 µM aprotinin, pH 7.5]. Proteins of these homogenates were separated by SDS-PAGE by using 10% resolving gels (Tris · HCl ready gels, Bio-Rad, Hercules, CA). Proteins were transferred from the gel to a nitrocellulose membrane at 100 V for 60 min. The membranes were blocked with 3% BSA in 139 mM NaCl, 2.7 mM KH2PO4, 9.9 mM Na2HPO4, and 0.05% Tween 20 (PBST) and 1% sodium azide. After two 5-min washes in 139 mM NaCl, 2.7 mM KH2PO4, and 9.9 mM Na2HPO4 (PBS), membranes were incubated with GLUT-4 polyclonal antibody RaIRGT (Biogenesis, Sandown, NH) for 1 h at room temperature. After two 5-min washes in PBST and two 5-min washes in PBS, membranes were exposed to horseradish peroxidase-conjugated donkey anti-rabbit IgG (Amersham) for 1 h at room temperature. After being washed twice with PBST and twice with PBS, the membranes were incubated in enhanced chemiluminescence-detection reagent and then visualized on enhanced chemiluminescence hyperfilm (Amersham). Relative amounts of GLUT-4 were then quantified by using a Hewlett-Packard ScanJet 6200C and SigmaGel software (SPSS, Chicago, IL). Total intensity of GLUT-4 spots on the developed hyperfilm was expressed as a fraction of intensity shown by a GLUT-4 standard run on the same gel. The GLUT-4 standard was a plasma membrane fraction prepared as described previously (22).
Preparation of nuclear extracts.
Twelve hours after an IP injection of AICAR (1.0 mg/g body wt) or
saline, mice and rats were euthanized, and both gastrocnemius muscles
were harvested and frozen in liquid nitrogen. The frozen tissues were
pulverized in liquid nitrogen and homogenized in 10 volumes of
homogenization buffer A (250 mM sucrose, 10 mM HEPES, pH
7.6, 25 mM KCl, 1 mM EDTA, 10% glycerol, 0.1 mM PMSF, 0.5 mM benzamidine, 2 µg/ml each aprotinin, leupeptin, and pepstatin A, 2 mM
levamisole, 10 mM
-glycerophosphate, and 1 mM sodium vanadate) with 10 strokes of a Teflon pestle. The homogenate was centrifuged 10 min at 2,400 g at 4°C. The pellet was
resuspended in 10 ml of homogenization buffer A and
homogenized with 10 strokes of a Dounce homogenizer with a tight
fitting pestle. The homogenate was layered over one-half volume of
buffer A-1.0 (buffer A with addition of 1.0 M
sucrose) and centrifuged at 2,400 g for 10 min at 4°C. The
pellet was resuspended in 2 volumes of buffer A-1.0 and
repelleted by microcentrifugation at 16,000 g for 20 s.
The crude nuclear pellet was then resuspended in 1 volume of nuclear extraction buffer (10 mM HEPES, pH 7.6, 325 mM NaCl, 3 mM
MgCl2, 0.1 mM EDTA, 10% glycerol, 1 mM DTT, 0.1 mM PMSF,
0.5 mM benzamidine, 2 µg/ml each aprotinin, leupeptin, and pepstatin
A) and incubated on ice for 20 min, and the particulate material was
removed by centrifugation at 16,000 g in a microcentrifuge
for 10 min at 4°C. The supernatant was dialyzed against buffer
C (25 mM HEPES, pH 7.6, 100 mM KCl, 0.1 mM EDTA, 10% glycerol, 1 mM DTT, 0.1 mM PMSF, 0.5 mM benzamidine, 2 µg/ml each aprotinin,
leupeptin, and pepstatin A, 2 mM levamisole, 10 mM
-glycerophosphate, and 1 mM sodium vanadate) for 4 h. The
dialysate was assayed for total protein (Bradford) and stored at
70°C.
Electrophoretic mobility shift assays. Electrophoretic mobility shift assays were performed as previously described (41). Oligonucleotides containing the human GLUT-4 MEF-2 DNA binding site (GGGAGCTAAAAATAGCAG and its complement) and human GLUT-4 domain I DNA binding site (CTTGTCCCTCGGACCGGCTCCAGGAACCAA and its complement) were custom synthesized (GIBCO BRL). Oligonucleotides containing the OCT1 DNA binding site were commercially prepared (Santa Cruz). Oct-1 oligonucleotide binding serves as a negative control for DNA binding activity to a constitutively active transcription factor that would not be expected to be changed by the experimental treatment. Oligonucleotides were end-labeled with T4 polynucleotide kinase. Labeled probes (0.5 ng) were incubated with 5 µg of total protein isolated from nuclei in a 10 µl reaction containing 2 µg poly(dI-dC), 40 mM KCl, 5 mM MgCl2, 15 mM HEPES, pH 7.9, 1 mM EDTA, 0.5 mM DTT, and 5% glycerol for 20 min at room temperature. For competition studies, extracts were preincubated with 20-fold unlabeled oligonucleotide as indicated for 5 min before addition of the radiolabeled probe. Preincubation was carried out for 1 h on ice before addition of the radioactive probe. Similarly, electrophoretic gel supershift studies were carried out by preincubating the nuclear extracts with 2.5 µg of either the MEF-2A, MEF-2B, or MEF-2D antibodies (a gift from Dr. Ron Prywes) or preimmune IgG. Preincubation was carried out for 1 h on ice before addition of the radioactive probe. Samples were electrophoresed on a nondenaturing 6% polyacrylamide gel (29:1 acrylamide-bis acrylamide) buffered with Tris-borate/EDTA (22 mM Tris, 22 mM boric acid, and 0.5 mM EDTA) at 300 V for 25 min at room temperature. Gels were then dried and exposed to film at room temperature.
| |
RESULTS |
|---|
|
|
|---|
The effect of AICAR on GLUT-4 mRNA levels.
Previously our laboratory reported that chronic AICAR treatment in rats
led to the accumulation of more GLUT-4 protein than is found in
saline-injected controls (14). To investigate whether this
effect on GLUT-4 protein was the consequence of a pretranslational regulation by AICAR, GLUT-4 mRNA was examined by Northern blot analysis
after a single subcutaneous injection of AICAR in rats and mice. A
representative Northern blot showing GLUT-4 and GAPDH mRNA 16 h
after an injection of saline or AICAR in rats is shown in Fig.
2A. GAPDH levels did not
differ between saline and AICAR-injected animals with or without
normalization to 18S ribosomal RNA. The GLUT-4/GAPDH ratio was ~50%
higher in the AICAR-injected group of rats. Of interest was the time
course of AICAR-induced increase in GLUT-4 mRNA. GLUT-4 mRNA levels
were elevated (~30%) by 7 h, peaked at 13 h (~60%),
remained elevated at 16 h (~45%), but had returned to normal by
24 h (Fig. 2B). Similar GLUT-4 mRNA time course
response was confirmed in mice with smaller group sample number
(2-4 mice per each time point, data not shown). This result suggested a transient increase in the rate of transcription of GLUT-4
gene in response to AICAR.
|
Fiber type-specific responses of GLUT-4 to AICAR.
The gastrocnemius muscle is mixed with respect to fiber type
composition. Previously, our laboratory (51) reported that 4 wk of chronic AICAR treatment led to an increase in GLUT-4 protein in
red and white quadriceps, but not soleus muscle. With a 2-wk regimen of
chronic AICAR treatment designed to minimize the downregulation of the
AICAR response, we again observed that GLUT-4 protein levels were
higher with AICAR treatment in both red (~30%) and white (~115%)
quadriceps, but not in the soleus muscle (Fig.
3). We investigated whether the acute
effect of AICAR on GLUT-4 mRNA levels was also fiber type specific by
examining AICAR-induced GLUT-4 expression in red and white quadriceps
and soleus muscles 16 h after an injection of saline or AICAR.
GLUT-4 mRNA levels increased 70% in white quadriceps and 50% in red
quadriceps muscles, but no difference between saline and AICAR-injected
rats in GLUT-4 mRNA was observed in the soleus (Fig.
4). Thus AICAR treatment leads to an
acute elevation in GLUT-4 mRNA levels, which, when treated chronically,
leads to the accumulation of GLUT-4 protein, and these effects appear
to differ with respect to muscle fiber type composition. The
most profound effect of AICAR on GLUT-4 expression was observed in
white quadriceps (primarily type IIb fibers), a less dramatic effect
was observed in red quadriceps (primarily type IIa fibers), and no
effect was observed in the soleus (primarily type 1 fibers).
|
|
Regulation of human GLUT-4 promoter in transgenic mice by AICAR.
Previously our laboratory observed an increase in the concentration of
ZMP and the activity of AMPK in rat skeletal muscle within 60 min of a
single subcutaneous injection of AICAR (14). A single
subcutaneous injection of AICAR in mice also leads to detectable
amounts of ZMP and increased AMPK activity in the gastrocnemius muscle
of mice (Table 1). As with the rats, no
detectable change was observed in mice gastrocnemius ATP or ADP
concentrations in response to the AICAR injection (data not shown). We
also observed similar time course responses in the elevation of
endogenous GLUT-4 mRNA in AICAR-injected mice as in rats, with
gastrocnemius GLUT-4 mRNA peaking ~13 h after treatment (data not
shown).
|
1,154 bp of promoter, it is also possible that there are subtle
species-specific differences in the GLUT-4 promoter sensitivity to
transcription factors. In addition, the CAT mRNA stability could also
contribute to this observation, because the construct of the CAT gene
has been modified on the 3' end to increase CAT mRNA stability.
|
|
AICAR injection increases the MEF-2 binding activity.
It has been shown recently that MEF-2 and domain I binding domains on
human GLUT-4 gene promoter are two regulatory domains that function
cooperatively (33, 41). Nuclear extracts were prepared
from gastrocnemius muscles obtained from AICAR- and saline-treated mice
and rats. Electrophoretic mobility shifts of the MEF-2, domain I, and
OCT-1 oligonucleotides demonstrated an increase in binding activity of
MEF-2 to GLUT-4 promoter from AICAR-treated mouse muscle
nuclear extracts compared with the saline control extracts (Fig.
7). In contrast, binding of domain I to
GLUT-4 promoter was slightly decreased in AICAR-treated nuclear
extracts. As a control, binding of OCT-1 was unchanged after AICAR
treatment. Similar results were observed in rats (data not shown). Thus
the increased binding of MEF-2 to the GLUT-4 promoter may contribute to
AICAR-induced GLUT-4 transcription.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The present study demonstrated that AICAR, an activator of AMPK, increases transcription of the GLUT-4 gene in muscle, and chronic treatment increases the total GLUT-4 protein. The increased transcription of GLUT-4 and its protein levels in muscle after AICAR treatment appears to be fiber type specific. The red and white hindlimb muscles both responded to AICAR treatment with increased GLUT-4 transcription and protein levels. However, in the soleus neither GLUT-4 mRNA or protein level showed difference after AICAR treatment. These findings are in agreement with our laboratory's previous study with a different AICAR treatment regime that GLUT-4 protein was elevated only in red and white quadriceps, but not soleus muscle (51). In agreement with our results, a recent study also shows that 5 days chronic treatment with AICAR increased GLUT-4 protein and mRNA levels in white muscle (1). The mechanism mediating this fiber type tissue-dependent GLUT-4 gene expression is still unclear at this time. As a muscle composed of predominantly oxidative fibers, the soleus has a higher level of GLUT-4 gene expression. Therefore one possibility is that, with relatively high initial GLUT-4 level, it could be less likely to show any further increase after AICAR treatment.
AMPK is a heterotrimeric protein consisting of one catalytic subunit
(
) and two noncatalytic subunits (
and
) (12).
Two isoforms of the
subunit have been identified (
1 and
2),
which have broad tissue distribution, and the highest expression level of the
2 isoform is found in skeletal muscle, suggesting a
physiological role for AMPK in this tissue (39, 45).
Interestingly, contraction preferentially activated the
2 isoform
(45). The
2 isoform has also been observed to be
preferentially targeted to the nucleus (38). After
entering the cell, AICAR is phosphorylated and accumulates as ZMP,
thereafter mimicking the ability of AMP to activate AMPK. AMP activates
AMPK through both covalent and noncovalent mechanisms (12). Increased AMP concentrations cause AMP-activated
protein kinase kinase (AMPKK), an upstream kinase, to phosphorylate
AMPK, thereby increasing its activity. In addition, an increased AMP concentration allosterically activates the enzyme. ZMP mimics all
effects of AMP on the AMPK system, including stimulation of phosphorylation of AMPK by AMPKK. This method of activating AMPK has
the advantage that it does not disturb the levels of ATP, ADP, or AMP
in the muscle (27), and therefore any changes seen are not
merely due to depletion of ATP. The present study did not find any
detectable change in ATP and ADP levels in muscle after a single
injection of AICAR.
Infusion of AICAR in vivo has previously been shown to cause hypoglycemia in mice (47). It was suggested that the hypoglycemia was caused by inhibition of gluconeogenesis, a known effect of AMPK activation (48). Recent studies have also demonstrated that AICAR-mediated activation of AMPK stimulates skeletal muscle glucose uptake through the translocation of GLUT-4 to the cell surface in muscle tissue (22, 36). We could not exclude the possibility of a direct effect of lower glucose and insulin level or any effects associated with the accompanying metabolic acidosis on the GLUT-4 gene expression regulation. However, transcriptional run-on analysis has shown that increased levels of glucose and/or insulin increase GLUT-4 gene transcription in muscle; i.e., lower glucose and insulin would be predicted to decrease transcription (19). It is also demonstrated, by analysis of the human GLUT-4 promoter in transgenic mice, that GLUT-4 expression is downregulated in insulin-deficient STZ diabetic muscle (32). In previous study, 24 h fasting and refeeding did not show an effect on CAT and endogenous GLUT-4 mRNA level in transgenic mice with 2.4-kb human GLUT-4 promoter attached to the CAT reporter gene construct (25). The recent observation that increased expression of GLUT-4 and hexokinase is observed after in vitro incubation of isolated epitrochlearis muscles with AICAR for 18 h provides additional evidence that this is an effect of AMPK activation rather than a result of humoral changes secondary to the AICAR injection (31).
There is growing evidence to suggest that AMPK is an important component of a protein kinase cascade that monitors cellular energy charge, being activated by a rise in the cellular AMP-ATP ratio. AMPK appears to act as a "metabolic master switch" (12, 50), regulating metabolism both via direct phosphorylation of metabolic enzymes and via effects on gene expression. In addition to our findings, there are a number of features that provide clues for a role of AMPK in gene regulation. It was previously reported that AMPK is structurally and functionally related to the yeast SNF1 protein kinase complex (2). The activity of SNF1 is essential for the transcriptional regulation of glucose-inducible genes (3, 28). This is achieved through the phosphorylation of a transcription factor (6), depending on the medium glucose concentration. Recently, a role for mammalian AMPK in gene regulation has been confirmed as AICAR-activated AMPK is reported to inhibit phospho(enol )pyruvate carboxykinase (PEPCK) gene transcription (26) and glucose-induced transcription of L-pyruvate kinase, Spot 14, and fatty acid synthase genes (7, 23).
Numerous studies have shown that exercise training increases muscle GLUT-4 mRNA and protein in skeletal muscle (4, 10, 16, 30). Nuclear run-on analysis demonstrated that GLUT-4 transcription was increased after 3 h and returned to control values after 24 h (29). A recent study on transcriptional regulation of gene expression during recovery from exercise demonstrated that exercise induces transient increases in transcription of metabolic genes in human skeletal muscle (34). Further evidence that GLUT-4 gene transcription is increased by exercise was provided by studies of transgenic mice by using 5'-deletion analysis of the mouse GLUT-4 minigene (43, 44). The present study shows that GLUT-4 gene expression is transcriptionally upregulated by AICAR-activated AMPK in muscle, providing additional evidence of AMPK involvement in regulation of muscle gene expression by exercise. Investigation of the pathway by which AMPK acts may therefore give insight into mediating mechanism of muscle contraction or exercise in regulation of gene expression of GLUT-4 and other muscle genes.
Considerable work has been done in attempts to understand the function
of the GLUT-4 gene promoter. Analysis of transgenic mice with
sequential 5' deletions and 3' internal deletions of human GLUT-4 gene
promoter has suggested that the first 895 base pairs upstream of the
major transcription initiation site of the human GLUT-4 gene contain
the major regulatory elements of the gene (32, 33, 41).
The cooperative activity between two cis elements within
this 895-bp proximal promoter, domain I and the MEF-2 site, are
necessary for the full function of the promoter. Domain I is located
between nucleotides
742 and
712, and the MEF-2 binding domain is
located between nucleotides
473 and
464 (both regions are
numbered relative to the major transcription start site).
In the present study, we show that transcriptional upregulation by
AICAR is fully functional in 1154 (1154-hG4-CAT) and 895 (895-hG4-CAT)
transgenic mice. Both of these constructs contain domain I and MEF-2
sites. However, transgene CAT mRNA level in the
730
transgenic mice (730-hG4-CAT) did not respond to AICAR injection,
whereas endogenous GLUT-4 mRNA responded to AICAR treatment compared
with saline injection. These data indicate that the element involved in
regulation of GLUT-4 gene transcription by AICAR-activated AMPK are
located within 895 bp of the human GLUT-4 promoter. The 730-hG4-CAT
transgenic construct had domain I (
742 to
712) truncated but left
the MEF-2 binding domain intact. A previous study has shown that the
human GLUT-4 proximal promoter deleted to position
730 (730-hG4-CAT)
supported a high level of transgene expression in muscle; however, the
transgene expression was not regulated in STZ-induced diabetes
(32). Previous studies have shown that deletion of domain
I inside the
895-bp transgenic construct (895
742/526-hG4-CAT) prevented transgene expression, regardless of the presence of the MEF-2
domain (33). The fact that AICAR had no effect in 730-hG4-CAT construct is most likely due to the disruption of the
cooperative activity between domain 1 and MEF-2. The lack of effect of
AICAR-treatment on expression of this transgenic construct is similar
to previous data showing that STZ-induced diabetes did not affect
expression of this construct. However, it is possible that other
transcription factors within 895 bp of the gene, especially between
895 and
730, may also be involved in the AICAR-induced increase in
GLUT-4 transcription in addition to MEF-2 and domain I. Studies using
the transgenic minigene suggested two regions of mouse GLUT-4 promoter,
possibly as exercise response elements (43, 44). One
region is between
551 and
442, upstream of a MEF-2 binding site
(
437/
428). Another region is between
1001 and
701 in mouse
GLUT-4 gene. The differences observed between our studies and these
studies may be due to species-specific differences in the gene sequences.
Because either a deletion of the domain I or mutation of the MEF-2 binding domain does not support the transgene expression, we were unable to directly study these two elements for GLUT-4 transcription upregulation by using deletional analysis. To investigate whether MEF-2 site and domain I are involved in the transcriptional upregulation of GLUT-4 gene by AICAR, we studied the effect of AICAR on DNA binding activity to MEF-2 site or domain I.
To our surprise, DNA binding activity to domain I was slightly decreased in AICAR-treated animals. At this stage, we could not explain the link between decreased DNA binding at domain I and increased GLUT-4 transcription by AICAR whereas domain I is required to function together with MEF-2 to support GLUT-4 transcription. It is possible that dynamic changes in protein-DNA interactions in the 895-bp proximal promoter results in upregulation of the GLUT-4 gene through an increased MEF-2 binding and a decreased domain I interaction.
The MEF-2 DNA binding site has been demonstrated to be necessary for human GLUT-4 gene transcription. A mutation inside the MEF-2 site ablated transgene mRNA expression in the 895-bp construct human GLUT-4 transgenic mice (41). The MEF-2 binding domain functions cooperatively with domain I to support transcription of the human GLUT-4 gene in transgenic mice (33). In addition to its role in tissue-specific expression, MEF-2 binding activity may be important for metabolic regulation of the GLUT-4 gene. MEF-2 binding activity is reduced in nuclear extracts from diabetic animals and insulin treatment of these animals returns MEF-2 binding activity to normal (41). It is also shown that MEF-2A protein levels are selectively reduced in skeletal muscle of insulin-deficient diabetic rats (41). This loss of MEF-2A expression accounts for the reduction in DNA binding activity and directly correlates with the decrease in GLUT-4 gene expression, suggesting that it plays a role in regulating the transcription rate of the GLUT-4 gene. The results in this study showed that MEF-2 binding activity to the GLUT-4 promoter was increased in AICAR-treated nuclear extracts. MEF-2 binding correlates well with the increased GLUT-4 gene transcription. For this reason, we postulate that the MEF-2 binding site is necessary and may be directly involved in regulating GLUT-4 expression by AICAR-activated AMPK.
In summary, we have demonstrated that AICAR-activated AMPK increases muscle GLUT-4 transcription in a fiber type-specific manner. The cis elements responsible for increased human GLUT-4 transcription are within the 895 base pairs upstream of the major transcriptional start site. Furthermore, the increased MEF-2 binding activity with AICAR treatment suggested that the MEF-2 domain is an important regulatory element in the human GLUT-4 gene promoter. We hypothesize that AMPK activation associated with muscle contraction and exercise not only plays important roles in stimulation of fatty acid oxidation and glucose uptake, but also appears to be important in modulating gene expression in the muscle. Identification of the specific phosphorylation targets involved in this process will greatly enhance identification of more specific mechanisms. Further studies using AMPK null transgenic models or AMPK specific inhibitors and assessment of both the GLUT-4 MEF-2 domain and domain I under the condition of muscle contraction or exercise could provide valuable insight into the regulation of muscle gene expression.
| |
ACKNOWLEDGEMENTS |
|---|
We gratefully acknowledge the expert technical assistance from Hongli Li, Brian Roberts, Edward B. Tapscott, and Tracey Woodlief.
| |
FOOTNOTES |
|---|
This work was supported by grants from the National Institutes of Health (DK-38416 to G. L. Dohm, AR-41438 to W. W. Winder, and DK-47894 to A. L. Olson) and American Diabetes Association (RA0064 to A. L. Olson and a mentor-based postdoctoral fellowship to P. S. MacLean).
Address for reprint requests and other correspondence: G. L. Dohm, Dept. of Biochemistry, Brody School of Medicine, East Carolina Univ., Greenville, NC 27858.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 8 December 2000; accepted in final form 30 April 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Buhl, ES,
Jessen N,
Schmitz O,
Pedersen SB,
Pedersen O,
Holman GD,
and
Lund S.
Chronic treatment with 5-aminoimidazole-4-carboxamide-1-
-D-ribofuranoside increases insulin-stimulated glucose uptake and GLUT-4 translocation in rat skeletal muscles in a fiber type-specific manner.
Diabetes
50:
12-17,
2001
2.
Carling, D,
Aguan K,
Woods A,
Verhoeven AJ,
Beri RK,
Brennan CH,
Sidebottom C,
Davison MD,
and
Scott J.
Mammalian AMP-activated protein kinase is homologous to yeast and plant protein kinases involved in the regulation of carbon metabolism.
J Biol Chem
269:
11442-11448,
1994
3.
Carlson, M,
Osmond BC,
and
Botstein D.
Mutants of yeast defective in sucrose utilization.
Genetics
98:
25-40,
1981
4.
Cox, JH,
Cortright RN,
Dohm GL,
and
Houmard JA.
Effect of aging on response to exercise training in humans: skeletal muscle GLUT-4 and insulin sensitivity.
J Appl Physiol
86:
2019-2025,
1999
5.
Davidson, MB.
Role of glucose transport and GLUT-4 transporter protein in type 2 diabetes mellitus.
J Clin Endocrinol Metab
77:
25-26,
1993[Web of Science][Medline].
6.
De Vit, MJ,
Waddle JA,
and
Johnston M.
Regulated nuclear translocation of the Mig1 glucose repressor.
Mol Biol Cell
8:
1603-1618,
1997[Abstract].
7.
Foretz, M,
Carling D,
Guichard C,
Ferre P,
and
Foufelle F.
AMP-activated protein kinase inhibits the glucose-activated expression of fatty acid synthase gene in rat hepatocytes.
J Biol Chem
273:
14767-14771,
1998
8.
Friedman, JE,
Sherman WM,
Reed MJ,
Elton CW,
and
Dohm GL.
Exercise training increases glucose transporter protein GLUT-4 in skeletal muscle of obese Zucker (fa/fa) rats.
FEBS Lett
268:
13-16,
1990[Web of Science][Medline].
9.
Gibbs, EM,
Stock JL,
McCoid SC,
Stukenbrok HA,
Pessin JE,
Stevenson RW,
Milici AJ,
and
McNeish JD.
Glycemic improvement in diabetic db/db mice by overexpression of the human insulin-regulatable glucose transporter (GLUT-4).
J Clin Invest
95:
1512-1518,
1995.
10.
Goodyear, LJ,
Hirshman MF,
Valyou PM,
and
Horton ES.
Glucose transporter number, function, and subcellular distribution in rat skeletal muscle after exercise training.
Diabetes
41:
1091-1099,
1992[Abstract].
11.
Goodyear, LJ,
and
Kahn BB.
Exercise, glucose transport, and insulin sensitivity.
Annu Rev Med
49:
235-261,
1998[Web of Science][Medline].
12.
Hardie, DG,
and
Carling D.
The AMP-activated protein kinase
fuel gauge of the mammalian cell.
Eur J Biochem
246:
259-273,
1997[Web of Science][Medline].
13.
Henin, N,
Vincent MF,
Gruber HE,
and
Van den Berghe G.
Inhibition of fatty acid and cholesterol synthesis by stimulation of AMP-activated protein kinase.
FASEB J
9:
541-546,
1995[Abstract].
14.
Holmes, BF,
Kurth-Kraczek EJ,
and
Winder WW.
Chronic activation of 5'-AMP-activated protein kinase increases GLUT-4, hexokinase, and glycogen in muscle.
J Appl Physiol
87:
1990-1995,
1999
15.
Houmard, JA,
Shinebarger MH,
Dolan PL,
Leggett-Frazier N,
Bruner RK,
McCammon MR,
Israel RG,
and
Dohm GL.
Exercise training increases GLUT-4 protein concentration in previously sedentary middle-aged men.
Am J Physiol Endocrinol Metab
264:
E896-E901,
1993
16.
Houmard, JA,
Weidner MD,
Dolan PL,
Leggett-Frazier N,
Gavigan KE,
Hickey MS,
Tyndall GL,
Zheng D,
Alshami A,
and
Dohm GL.
Skeletal muscle GLUT-4 protein concentration and aging in humans.
Diabetes
44:
555-560,
1995[Abstract].
17.
Hutber, CA,
Hardie DG,
and
Winder WW.
Electrical stimulation inactivates muscle acetyl-CoA carboxylase and increases AMP-activated protein kinase.
Am J Physiol Endocrinol Metab
272:
E262-E266,
1997
18.
Ikemoto, S,
Thompson KS,
Takahashi M,
Itakura H,
Lane MD,
and
Ezaki O.
High fat diet-induced hyperglycemia: prevention by low level expression of a glucose transporter (GLUT-4) minigene in transgenic mice.
Proc Natl Acad Sci USA
92:
3096-3099,
1995
19.
Jones, JP,
and
Dohm GL.
Regulation of glucose transporter GLUT-4 and hexokinase II gene transcription by insulin and epinephrine.
Am J Physiol Endocrinol Metab
273:
E682-E687,
1997
20.
Jones, JP,
Tapscott EB,
Olson AL,
Pessin JE,
and
Dohm GL.
Regulation of glucose transporters GLUT-4 and GLUT-1 gene transcription in denervated skeletal muscle.
J Appl Physiol
84:
1661-1666,
1998
21.
Kemp, BE,
Mitchelhill KI,
Stapleton D,
Michell BJ,
Chen ZP,
and
Witters LA.
Dealing with energy demand: the AMP-activated protein kinase.
Trends Biochem Sci
24:
22-25,
1999[Web of Science][Medline].
22.
Kurth-Kraczek, EJ,
Hirshman MF,
Goodyear LJ,
and
Winder WW.
5' AMP-activated protein kinase activation causes GLUT-4 translocation in skeletal muscle.
Diabetes
48:
1667-1671,
1999[Abstract].
23.
Leclerc, I,
Kahn A,
and
Doiron B.
The 5'-AMP-activated protein kinase inhibits the transcriptional stimulation by glucose in liver cells, acting through the glucose response complex.
FEBS Lett
431:
180-184,
1998[Web of Science][Medline].
24.
Leturque, A,
Loizeau M,
Vaulont S,
Salminen M,
and
Girard J.
Improvement of insulin action in diabetic transgenic mice selectively overexpressing GLUT-4 in skeletal muscle.
Diabetes
45:
23-27,
1996[Abstract].
25.
Liu, ML,
Olson AL,
Moye-Rowley WS,
Buse JB,
Bell GI,
and
Pessin JE.
Expression and regulation of the human GLUT-4/muscle-fat facilitative glucose transporter gene in transgenic mice.
J Biol Chem
267:
11673-11676,
1992
26.
Lochhead, PA,
Salt IP,
Walker KS,
Hardie DG,
and
Sutherland C.
5-aminoimidazole-4-carboxamide riboside mimics the effects of insulin on the expression of the 2 key gluconeogenic genes PEPCK and glucose-6-phosphatase.
Diabetes
49:
896-903,
2000[Abstract].
27.
Merrill, GF,
Kurth EJ,
Hardie DG,
and
Winder WW.
AICA riboside increases AMP-activated protein kinase, fatty acid oxidation, and glucose uptake in rat muscle.
Am J Physiol Endocrinol Metab
273:
E1107-E1112,
1997.
28.
Neigeborn, L,
and
Carlson M.
Genes affecting the regulation of SUC2 gene expression by glucose repression in Saccharomyces cerevisiae.
Genetics
108:
845-858,
1984
29.
Neufer, PD,
and
Dohm GL.
Exercise induces a transient increase in transcription of the GLUT-4 gene in skeletal muscle.
Am J Physiol Cell Physiol
265:
C1597-C1603,
1993
30.
Neufer, PD,
Shinebarger MH,
and
Dohm GL.
Effect of training and detraining on skeletal muscle glucose transporter (GLUT-4) content in rats.
Can J Physiol Pharmacol
70:
1286-1290,
1992[Web of Science][Medline].
31.
Ojuka, EO,
Nolte LA,
and
Holloszy JO.
Increased expression of GLUT-4 and hexokinase in rat epitrochlearis muscles exposed to AICAR in vitro.
J Appl Physiol
88:
1072-1075,
2000
32.
Olson, AL,
and
Pessin JE.
Transcriptional regulation of the human GLUT-4 gene promoter in diabetic transgenic mice.
J Biol Chem
270:
23491-23495,
1995
33.
Oshel, KM,
Knight JB,
Cao KT,
Thai MV,
and
Olson AL.
Identification of a 30-base pair regulatory element and novel DNA binding protein that regulates the human GLUT-4 promoter in transgenic mice.
J Biol Chem
275:
23666-23673,
2000
34.
Pilegaard, H,
Ordway GA,
Saltin B,
and
Neufer PD.
Transcriptional regulation of gene expression in human skeletal muscle during recovery from exercise.
Am J Physiol Endocrinol Metab
279:
E806-E814,
2000
35.
Ren, JM,
Semenkovich CF,
and
Holloszy JO.
Adaptation of muscle to creatine depletion: effect on GLUT-4 glucose transporter expression.
Am J Physiol Cell Physiol
264:
C146-C150,
1993
36.
Russell, RR,
Bergeron R, 3rd,
Shulman GI,
and
Young LH.
Translocation of myocardial GLUT-4 and increased glucose uptake through activation of AMPK by AICAR.
Am J Physiol Heart Circ Physiol
277:
H643-H649,
1999
37.
Sabina, RL,
Kernstine KH,
Boyd RL,
Holmes EW,
and
Swain JL.
Metabolism of 5-amino-4-imidazolecarboxamide riboside in cardiac and skeletal muscle. Effects on purine nucleotide synthesis.
J Biol Chem
257:
10178-10183,
1982
38.
Salt, I,
Celler JW,
Hawley SA,
Prescott A,
Woods A,
Carling D,
and
Hardie DG.
AMP-activated protein kinase: greater AMP dependence, and preferential nuclear localization, of complexes containing the
2 isoform.
Biochem J
334:
177-187,
1998.
39.
Stapleton, D,
Mitchelhill KI,
Gao G,
Widmer J,
Michell BJ,
Teh T,
House CM,
Fernandez CS,
Cox T,
Witters LA,
and
Kemp BE.
Mammalian AMP-activated protein kinase subfamily.
J Biol Chem
271:
611-614,
1996
40.
Stenbit, AE,
Tsao TS,
Li J,
Burcelin R,
Geenen DL,
Factor SM,
Houseknecht K,
Katz EB,
and
Charron MJ.
GLUT-4 heterozygous knockout mice develop muscle insulin resistance and diabetes.
Nat Med
3:
1096-1101,
1997[Web of Science][Medline].
41.
Thai, MV,
Guruswamy S,
Cao KT,
Pessin JE,
and
Olson AL.
Myocyte enhancer factor 2 (MEF-2)-binding site is required for GLUT-4 gene expression in transgenic mice. Regulation of MEF-2 DNA binding activity in insulin-deficient diabetes.
J Biol Chem
273:
14285-14292,
1998
42.
Treadway, JL,
Hargrove DM,
Nardone NA,
McPherson RK,
Russo JF,
Milici AJ,
Stukenbrok HA,
Gibbs EM,
Stevenson RW,
and
Pessin JE.
Enhanced peripheral glucose utilization in transgenic mice expressing the human GLUT-4 gene.
J Biol Chem
269:
29956-29961,
1994
43.
Tsunoda, N,
Cooke DW,
Ikemoto S,
Maruyama K,
Takahashi M,
Lane MD,
and
Ezaki O.
Regulated expression of 5'-deleted mouse GLUT-4 minigenes in transgenic mice: effects of exercise training and high-fat diet.
Biochem Biophys Res Commun
239:
503-509,
1997[Web of Science][Medline].
44.
Tsunoda, N,
Maruyama K,
Cooke DW,
Lane DM,
and
Ezaki O.
Localization of exercise- and denervation-responsive elements in the mouse GLUT-4 gene.
Biochem Biophys Res Commun
267:
744-751,
2000[Web of Science][Medline].
45.
Vavvas, D,
Apazidis A,
Saha AK,
Gamble J,
Patel A,
Kemp BE,
Witters LA,
and
Ruderman NB.
Contraction-induced changes in acetyl-CoA carboxylase and 5'-AMP-activated kinase in skeletal muscle.
J Biol Chem
272:
13255-13261,
1997
46.
Verhoeven, AJ,
Woods A,
Brennan CH,
Hawley SA,
Hardie DG,
Scott J,
Beri RK,
and
Carling D.
The AMP-activated protein kinase gene is highly expressed in rat skeletal muscle. Alternative splicing and tissue distribution of the mRNA.
Eur J Biochem
228:
236-243,
1995[Web of Science][Medline].
47.
Vincent, MF,
Erion MD,
Gruber HE,
and
Van den Berghe G.
Hypoglycaemic effect of AICAriboside in mice.
Diabetologia
39:
1148-1155,
1996[Web of Science][Medline].
48.
Vincent, MF,
Marangos PJ,
Gruber HE,
and
Van den Berghe G.
Inhibition by AICA riboside of gluconeogenesis in isolated rat hepatocytes.
Diabetes
40:
1259-1266,
1991[Abstract].
49.
Winder, WW,
and
Hardie DG.
Inactivation of acetyl-CoA carboxylase and activation of AMP-activated protein kinase in muscle during exercise.
Am J Physiol Endocrinol Metab
270:
E299-E304,
1996
50.
Winder, WW,
and
Hardie DG.
AMP-activated protein kinase, a metabolic master switch: possible roles in type 2 diabetes.
Am J Physiol Endocrinol Metab
277:
E1-E10,
1999
51.
Winder, WW,
Holmes BF,
Rubink DS,
Jensen EB,
Chen M,
and
Holloszy JO.
Activation of AMP-activated protein kinase increases mitochondrial enzymes in skeletal muscle.
J Appl Physiol
88:
2219-2226,
2000
52.
Zorzano, A,
Santalucia T,
Palacin M,
Guma A,
and
Camps M.
Searching for ways to upregulate GLUT-4 glucose transporter expression in muscle.
Gen Pharmacol
31:
705-713,
1998[Web of Science][Medline].
This article has been cited by other articles:
![]() |
G. R. Steinberg and B. E. Kemp AMPK in Health and Disease Physiol Rev, July 1, 2009; 89(3): 1025 - 1078. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Pandke, K. L. Mullen, L. A. Snook, A. Bonen, and D. J. Dyck Decreasing intramuscular phosphagen content simultaneously increases plasma membrane FAT/CD36 and GLUT4 transporter abundance Am J Physiol Regulatory Integrative Comp Physiol, September 1, 2008; 295(3): R806 - R813. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. F. Chehab Minireview: Obesity and LipOdystrophy--Where Do the Circles Intersect? Endocrinology, March 1, 2008; 149(3): 925 - 934. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Wolf, M. Arad, F. Ahmad, A. Sanbe, S. A. Bernstein, O. Toka, T. Konno, G. Morley, J. Robbins, J.G. Seidman, et al. Reversibility of PRKAG2 Glycogen-Storage Cardiomyopathy and Electrophysiological Manifestations Circulation, January 15, 2008; 117(2): 144 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Brown, M. Elstner, S. J. Yeaman, D. M. Turnbull, and M. Walker Does impaired mitochondrial function affect insulin signaling and action in cultured human skeletal muscle cells? Am J Physiol Endocrinol Metab, January 1, 2008; 294(1): E97 - E102. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Lira, Q. A. Soltow, J. H. D. Long, J. L. Betters, J. E. Sellman, and D. S. Criswell Nitric oxide increases GLUT4 expression and regulates AMPK signaling in skeletal muscle Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E1062 - E1068. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jager, C. Handschin, J. St.-Pierre, and B. M. Spiegelman AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1{alpha} PNAS, July 17, 2007; 104(29): 12017 - 12022. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Krawiec, G. J. Nystrom, R. A. Frost, L. S. Jefferson, and C. H. Lang AMP-activated protein kinase agonists increase mRNA content of the muscle-specific ubiquitin ligases MAFbx and MuRF1 in C2C12 cells Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1555 - E1567. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Miyamoto, T. Toyoda, T. Hayashi, S. Yonemitsu, M. Nakano, S. Tanaka, K. Ebihara, H. Masuzaki, K. Hosoda, Y. Ogawa, et al. Effect of acute activation of 5'-AMP-activated protein kinase on glycogen regulation in isolated rat skeletal muscle J Appl Physiol, March 1, 2007; 102(3): 1007 - 1013. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Towler and D. G. Hardie AMP-Activated Protein Kinase in Metabolic Control and Insulin Signaling Circ. Res., February 16, 2007; 100(3): 328 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Freyssenet Energy sensing and regulation of gene expression in skeletal muscle J Appl Physiol, February 1, 2007; 102(2): 529 - 540. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Jorgensen, E. A. Richter, and J. F. P. Wojtaszewski Role of AMPK in skeletal muscle metabolic regulation and adaptation in relation to exercise J. Physiol., July 1, 2006; 574(1): 17 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Nilsson, Y. C. Long, S. Martinsson, S. Glund, P. Garcia-Roves, L. T. Svensson, L. Andersson, J. R. Zierath, and M. Mahlapuu Opposite Transcriptional Regulation in Skeletal Muscle of AMP-activated Protein Kinase {gamma}3 R225Q Transgenic Versus Knock-out Mice J. Biol. Chem., March 17, 2006; 281(11): 7244 - 7252. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. F. Holmes, D. P. Sparling, A. L. Olson, W. W. Winder, and G. L. Dohm Regulation of muscle GLUT4 enhancer factor and myocyte enhancer factor 2 by AMP-activated protein kinase Am J Physiol Endocrinol Metab, December 1, 2005; 289(6): E1071 - E1076. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. O. Eijnde, W. Derave, J. F. P. Wojtaszewski, E. A. Richter, and P. Hespel AMP kinase expression and activity in human skeletal muscle: effects of immobilization, retraining, and creatine supplementation J Appl Physiol, April 1, 2005; 98(4): 1228 - 1233. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Ju, J. L. Smith, P. J. Oppelt, and J. S. Fisher Creatine feeding increases GLUT4 expression in rat skeletal muscle Am J Physiol Endocrinol Metab, February 1, 2005; 288(2): E347 - E352. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Hardie The AMP-activated protein kinase pathway - new players upstream and downstream J. Cell Sci., November 1, 2004; 117(23): 5479 - 5487. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Sigal, G. P. Kenny, D. H. Wasserman, and C. Castaneda-Sceppa Physical Activity/Exercise and Type 2 Diabetes Diabetes Care, October 1, 2004; 27(10): 2518 - 2539. [Full Text] [PDF] |
||||
![]() |
B. F. Holmes, D. B. Lang, M. J. Birnbaum, J. Mu, and G. L. Dohm AMP kinase is not required for the GLUT4 response to exercise and denervation in skeletal muscle Am J Physiol Endocrinol Metab, October 1, 2004; 287(4): E739 - E743. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Al-Khalili, A. V. Chibalin, M. Yu, B. Sjodin, C. Nylen, J. R Zierath, and A. Krook MEF2 activation in differentiated primary human skeletal muscle cultures requires coordinated involvement of parallel pathways Am J Physiol Cell Physiol, June 1, 2004; 286(6): C1410 - C1416. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. McGee and M. Hargreaves Exercise and Myocyte Enhancer Factor 2 Regulation in Human Skeletal Muscle Diabetes, May 1, 2004; 53(5): 1208 - 1214. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Clark, Z.-P. Chen, K. T. Murphy, R. J. Aughey, M. J. McKenna, B. E. Kemp, and J. A. Hawley Intensified exercise training does not alter AMPK signaling in human skeletal muscle Am J Physiol Endocrinol Metab, May 1, 2004; 286(5): E737 - E743. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Frosig, S. B. Jorgensen, D. G. Hardie, E. A. Richter, and J. F. P. Wojtaszewski 5'-AMP-activated protein kinase activity and protein expression are regulated by endurance training in human skeletal muscle Am J Physiol Endocrinol Metab, March 1, 2004; 286(3): E411 - E417. [Abstract] [Full Text] |
||||
![]() |
C.-H. Kuo, H. Hwang, M.-C. Lee, A. L. Castle, and J. L. Ivy Role of insulin on exercise-induced GLUT-4 protein expression and glycogen supercompensation in rat skeletal muscle J Appl Physiol, February 1, 2004; 96(2): 621 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Knight, C. A. Eyster, B. A. Griesel, and A. L. Olson Regulation of the human GLUT4 gene promoter: Interaction between a transcriptional activator and myocyte enhancer factor 2A PNAS, December 9, 2003; 100(25): 14725 - 14730. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Moreno, A. L. Serrano, T. Santalucia, A. Guma, C. Canto, N. J. Brand, M. Palacin, S. Schiaffino, and A. Zorzano Differential Regulation of the Muscle-specific GLUT4 Enhancer in Regenerating and Adult Skeletal Muscle J. Biol. Chem., October 17, 2003; 278(42): 40557 - 40564. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Garcia-Roves, D.-H. Han, Z. Song, T. E. Jones, K. A. Hucker, and J. O. Holloszy Prevention of glycogen supercompensation prolongs the increase in muscle GLUT4 after exercise Am J Physiol Endocrinol Metab, October 1, 2003; 285(4): E729 - E736. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. BAAR, Z. SONG, C. F. SEMENKOVICH, T. E. JONES, D.-H. HAN, L. A. NOLTE, E. O. OJUKA, M. CHEN, and J. O. HOLLOSZY Skeletal muscle overexpression of nuclear respiratory factor 1 increases glucose transport capacity FASEB J, September 1, 2003; 17(12): 1666 - 1673. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. I. Itani, A. K. Saha, T. G. Kurowski, H. R. Coffin, K. Tornheim, and N. B. Ruderman Glucose Autoregulates Its Uptake in Skeletal Muscle: Involvement of AMP-Activated Protein Kinase Diabetes, July 1, 2003; 52(7): 1635 - 1640. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wu, H. Motoshima, K. Mahadev, T. J. Stalker, R. Scalia, and B. J. Goldstein Involvement of AMP-Activated Protein Kinase in Glucose Uptake Stimulated by the Globular Domain of Adiponectin in Primary Rat Adipocytes Diabetes, June 1, 2003; 52(6): 1355 - 1363. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. O. OJUKA, T. E. JONES, D.-H. HAN, M. CHEN, and J. O. HOLLOSZY Raising Ca2+ in L6 myotubes mimics effects of exercise on mitochondrial biogenesis in muscle FASEB J, April 1, 2003; 17(6): 675 - 681. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. McGee, K. F. Howlett, R. L. Starkie, D. Cameron-Smith, B. E. Kemp, and M. Hargreaves Exercise Increases Nuclear AMPK {alpha}2 in Human Skeletal Muscle Diabetes, April 1, 2003; 52(4): 926 - 928. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Nielsen, K. J. W. Mustard, D. A. Graham, H. Yu, C. S. MacDonald, H. Pilegaard, L. J. Goodyear, D. G. Hardie, E. A. Richter, and J. F. P. Wojtaszewski 5'-AMP-activated protein kinase activity and subunit expression in exercise-trained human skeletal muscle J Appl Physiol, February 1, 2003; 94(2): 631 - 641. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Park, S. R. Paulsen, S. R. Gammon, K. J. Mustard, D. G. Hardie, and W. W. Winder Effects of thyroid state on AMP-activated protein kinase and acetyl-CoA carboxylase expression in muscle J Appl Physiol, December 1, 2002; 93(6): 2081 - 2088. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Stoppani, A. L. Hildebrandt, K. Sakamoto, D. Cameron-Smith, L. J. Goodyear, and P. D. Neufer AMP-activated protein kinase activates transcription of the UCP3 and HKII genes in rat skeletal muscle Am J Physiol Endocrinol Metab, December 1, 2002; 283(6): E1239 - E1248. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. O. Ojuka, T. E. Jones, D.-H. Han, M. Chen, B. R. Wamhoff, M. Sturek, and J. O. Holloszy Intermittent increases in cytosolic Ca2+ stimulate mitochondrial biogenesis in muscle cells Am J Physiol Endocrinol Metab, November 1, 2002; 283(5): E1040 - E1045. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. W Booth, M. V Chakravarthy, and E. E Spangenburg Exercise and gene expression: physiological regulation of the human genome through physical activity J. Physiol., September 1, 2002; 543(2): 399 - 411. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Dohm Exercise Effects on Muscle Insulin Signaling and Action: Invited Review: Regulation of skeletal muscle GLUT-4 expression by exercise J Appl Physiol, August 1, 2002; 93(2): 782 - 787. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Hawley, A. E. Gadalla, G. S. Olsen, and D. G. Hardie The Antidiabetic Drug Metformin Activates the AMP-Activated Protein Kinase Cascade via an Adenine Nucleotide-Independent Mechanism Diabetes, August 1, 2002; 51(8): 2420 - 2425. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hoppeler and M. Fluck Normal mammalian skeletal muscle and its phenotypic plasticity J. Exp. Biol., August 1, 2002; 205(15): 2143 - 2152. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. W. Booth, M. V. Chakravarthy, S. E. Gordon, and E. E. Spangenburg Waging war on physical inactivity: using modern molecular ammunition against an ancient enemy J Appl Physiol, July 1, 2002; 93(1): 3 - 30. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sakamoto and L. J. Goodyear Exercise Effects on Muscle Insulin Signaling and Action: Invited Review: Intracellular signaling in contracting skeletal muscle J Appl Physiol, July 1, 2002; 93(1): 369 - 383. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. Durante, K. J. Mustard, S.-H. Park, W. W. Winder, and D. G. Hardie Effects of endurance training on activity and expression of AMP-activated protein kinase isoforms in rat muscles Am J Physiol Endocrinol Metab, July 1, 2002; 283(1): E178 - E186. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Bolster, S. J. Crozier, S. R. Kimball, and L. S. Jefferson AMP-activated Protein Kinase Suppresses Protein Synthesis in Rat Skeletal Muscle through Down-regulated Mammalian Target of Rapamycin (mTOR) Signaling J. Biol. Chem., June 28, 2002; 277(27): 23977 - 23980. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Paulsen, D. S. Rubink, and W. W. Winder AMP-activated protein kinase activation prevents denervation-induced decline in gastrocnemius GLUT-4 J Appl Physiol, November 1, 2001; 91(5): 2102 - 2108. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. O. Ojuka, T. E. Jones, L. A. Nolte, M. Chen, B. R. Wamhoff, M. Sturek, and J. O. Holloszy Regulation of GLUT4 biogenesis in muscle: evidence for involvement of AMPK and Ca2+ Am J Physiol Endocrinol Metab, May 1, 2002; 282(5): E1008 - E1013. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |