|
|
||||||||
1 Department of Sports
Medicine, Endothelin-1 (ET-1) is a potent vasoconstrictor
peptide, which also potentiates contractions to norepinephrine in human
internal mammary and coronary vessels. Exercise causes a redistribution of blood flow, i.e., the increase in working muscles that is partly attributable to a decrease in visceral blood flow. We hypothesized that
exercise causes a tissue-specific increase in ET-1 expression in
internal organs. We studied whether exercise affects expression of
preproET-1 mRNA in the kidneys and lungs. The rats performed treadmill
running (0% grade) for 45 min at a speed of 25 m/min. The plasma
concentrations of ET-1, epinephrine, and norepinephrine were greater in
the exercise rats than in the sedentary control rats. The expression of
preproET-1 mRNA in the kidneys was markedly higher in the exercise rats
than in the sedentary control rats, whereas that in the lungs did not
differ between the two groups. Therefore, the present study provides a
possibility that the exercise-induced increase in production of ET-1 in
the kidneys causes vasoconstriction and hence decreases blood flow in
the kidneys through its direct vasoconstrictive action and/or
its indirect effect of enhancing vasoconstrictions to norepinephrine.
treadmill running; splanchnic circulation; preproendothelin-1 mRNA; kidney; lung
ENDOTHELIN-1 (ET-1) is a potent vasoconstrictor
peptide produced by vascular endothelial cells (28, 36). It has been
reported that low concentrations of ET-1, which did not produce
vasoconstriction, potentiated contractions to norepinephrine in human
internal mammary and coronary vessels (37). In experimental animals, it
has also been demonstrated that a low dose of ET-1 enhances adrenergic vasoconstriction in perfused rat mesentric arteries (32). Thus it was
thought that endogenous ET-1 contributes to the regulation of vascular
tonus through its direct vasoconstrictive action and/or an
indirect effect of ET-1, enhancement of the vasoconstrictive action of
norepinephrine. Furthermore, it has been reported that systemic
administration of an endothelin-receptor antagonist significantly decreased systemic blood pressure and peripheral vascular resistance in
healthy humans, strongly suggesting that endogenously generated ET-1
contributes to basal vascular tonus in humans (8). We previously
reported that the arteriovenous difference in ET-1 concentration in nonworking muscles was significantly increased after
exercise, whereas that in the working muscles was not significantly different before and after exercise (17). These findings suggested that
the production of ET-1 is increased in the circulation of nonworking
muscles by exercise. However, it is not known how exercise affects the
production of ET-1 in internal organs.
Endurance exercise results in a significant redistribution of tissue
blood flow, by which the blood flow is greatly increased in the working
muscles, whereas it is decreased in the splanchnic circulation (such as
in the kidneys and intestines) and in the nonworking muscle circulation
(1, 5, 21-23, 35). Although it has been considered that the
exercise-induced redistribution of blood flow is partly caused by the
increased activity of the sympathetic nerve system (3) and multiple
local metabolic factors (14), the precise mechanisms are not known. It
has also been demonstrated that endothelium-derived relaxing factor,
which is identical to nitric oxide (NO) (9, 25), is partly involved in
determining the pattern of the redistribution of tissue blood flow
during exercise (31). Although this finding suggests that vascular
endothelial cells may be involved in the exercise-induced redistribution of blood flow, the roles of endothelium-derived vasoconstrictor substances, such as ET-1, in exercise-induced physiological responses remain to be investigated.
We previously reported that the arteriovenous difference in ET-1
concentration in nonworking muscles was significantly increased after
exercise, whereas that in the working muscles was not significantly different before and after exercise (17). However, it is unclear how
exercise affects the production of ET-1 in internal organs. To answer
this question, the present study was designed to investigate whether
exercise affects preproET-1 mRNA expression in the
internal organs, such as the kidneys and lungs. Exercise results in a
marked decrease in renal blood flow (6, 15, 33), whereas it increases cardiac output and pulmonary blood flow. Because ET-1 is a powerful vasoconstrictor peptide produced by the endothelium of blood vessels, we hypothesized that preproET-1 mRNA expression in the kidney (in which
the blood flow during exercise is decreased) would be augmented after
an acute bout of exercise. Therefore, we investigated preproET-1 mRNA
expression in the kidneys (in which the blood flow during exercise is
decreased) and in the lungs (in which the blood flow during exercise is
increased) after acute exercise. In the present study, the rats
performed treadmill running for 45 min. Immediately after this
exercise, the lungs and kidneys were removed and preproET-1 mRNA
expression in these organs was determined.
Animals and protocol.
Twelve male Wistar rats (7 wk old) were obtained from Clea Japan
(Tokyo, Japan) and cared for according to the Guide
for the Care and Use of Laboratory Animals [DHEW
Publication No. (NIH) 86-23, Revised 1985, Office of Science and
Health Reports, DRR/NIH, Bethesda, MD 20892] based on the 1964 Helsinki Declaration. The rats were maintained on a 12:12-h light-dark
cycle and received food and water ad libitum. All rats were
familiarized with running on a motor-driven treadmill 5 days/wk, over a
4-wk period, until they were capable of running at a speed of 25 m/min
for 45 min at no incline (0% grade). The running time and the speed of
the treadmill were gradually increased in 4 wk from 10 min at 10 m/min to 45 min at 25 m/min. Systolic arterial pressure and heart rate of the
animals were measured with a tail-cuff sphygmomanometer (PS-100, Riken
Kaihatsu, Kanagawa, Japan) on the day before the experiment. The body
weight of the animals was also measured on the day before the
experiment. The day of experiment, the rats were randomly divided into
two groups. In one group, six animals performed treadmill running (0%
grade) for 45 min at a speed of 25 m/min (exercise group). The other
six animals served as the sedentary control (sedentary control
group).
![]()
ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References
![]()
METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References
80°C for
measurement of plasma ET-1 concentration by a sandwich-enzyme immunoassay (EIA), for measurement of plasma epinephrine concentration and plasma norepinephrine concentration by radioenzymatic assay, and
for determination of preproET-1 mRNA expression by RT-PCR analysis. The
animals in the sedentary control group were killed ~24 h after their
last bout of exercise, i.e., at the same time point as was the exercise
group.
Measurement of plasma ET-1 concentration by sandwich-EIA.
Each blood sample was placed into a chilled tube containing aprotinin
(300 kallikrein-inhibiting units/ml) and EDTA (2 mg/ml) and centrifuged
at 3,000 g for 15 min at 4°C. The
plasma was stored at
80°C until use. Plasma ET-1
concentration was measured by a sandwich-EIA as previously
described in our papers (16, 17, 19, 20, 24, 29). In
brief, plasma (1 ml) was acidified with 3 ml of 4% acetic acid, and
immunoreactive ET-1 was extracted with a Sep-Pak
C18 cartridge (Waters, Milford,
MA). The elutes were reconstituted with 0.25 ml of assay buffer and
subjected to a sandwich-EIA for ET-1. A sandwich-EIA for ET-1 was
carried out as previously described with the immobilized mouse
monoclonal antibody AwETN40, which recognizes the
NH2-terminal portion of ET-1, and
peroxidase-labeled rabbit anti-ET-1 COOH-terminal peptide (15-21)
Fab' (16-19, 29). The coefficient of variation of the ET-1 assay
for the intra-assay variation was 11%, and the coefficient of
variation for the interassay variation was 13% (18).
Measurement of plasma epinephrine and norepinephrine concentrations. Plasma norepinephrine concentration and plasma epinephrine concentration were measured by using a radioenzymatic assay on the basis of the method of Peuler and Johnson (26). Plasma samples from each animal were determined in triplicate.
RT-PCR to determine levels of preproET-1 mRNA in the kidneys and lungs. The expression of preproET-1 mRNA in the kidneys and lungs was analyzed by RT-PCR. The expression of GAPDH mRNA was also determined as an internal control.
Total tissue RNA was isolated by acid guanidinium thiocyanate-phenol-chloroform extraction with Isogen (Nippon Gene, Toyama, Japan) according to the manufacturer's instructions. The tissue was homogenized in Isogen (100 mg tissue/1 ml Isogen) with a polytron tissue homogenizer (PT10SK/35, Kinematica, Lucerne, Switzerland). The chloroform extraction, isopropanol precipitation, and 75% (vol/vol) ethanol washing of the precipitated RNA were subsequently performed. The obtained RNA was resolved in pyrocarbonic acid diethyl ester-treated water and treated with DNase I (Takara, Shiga, Japan) and extracted again by Isogen to eliminate the genomic DNA. The RNA concentration was determined spectrophotometrically at 260 nm. Total tissue RNA (10 µg) was primed with 0.05 µg oligo(dT) 12-18 and reverse transcribed by avian myelloblastosis virus reverse transcriptase by using a first-strand cDNA synthesis kit (Life Sciences). The reaction was performed at 43°C for 60 min. The cDNA was diluted in a 1:10 ratio, and 1 µl was used for PCR. Each PCR reaction contained 10 mM Tris · HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 200 µM of each dNTP, 0.5 µM of each gene-specific primer, and 0.025 U/µl Taq polymerase (Takara). The gene-specific primers were synthesized according to the published cDNA sequences for each of the following: preproET-1 (30) and GAPDH (34). The sequences of the oligonucleotides were as follows: preproET-1 (sense): 5'TCTTCTCTCTGCTGTTTGTG3'; preproET-1 (antisense): 5'TAGTTTTCTTCCCTCCACC3'; GAPDH (sense): 5'GCCATCAACGACCCCTTCATTG3'; and GAPDH (antisense): 5'TGCCAGTGAGCTTCCCGTTC3'. PCR was carried out by using a PCR thermal cycler (TP-3000, Takara). The cycle profile included denaturation for 15 s at 94°C, annealing for 15 s at each suitable temperature, and extension for each suitable time at 72°C. The annealing temperature was set as follows: preproET-1, 54°C and GAPDH, 58°C. The extension time was set as follows: preproET-1, 1 min and GAPDH, 30 s. The reaction cycles of PCR were performed in the range that demonstrated a linear correlation between the amount of cDNA and the yield of PCR products (45 cycles: preproET-1 mRNA in kidney, 28 cycles: preproET-1 mRNA in lungs, 24 cycles: GAPDH mRNA in kidney, and 26 cycles: GAPDH mRNA in lungs). The PCR products were found to be of the expected size, as shown by 1.5% agarose gel electrophoresis. In addition, the specificity of the amplified sequences was confirmed by restriction enzyme analysis and DNA sequencing. The DNA sequence of each amplicon was perfectly matched to each published sequence.Quantitative analysis of PCR products. The amplified PCR products were electrophoresed on 1.5% agarose gels, stained with ethidium bromide, visualized by a ultraviolet transilluminator, and photographed. The photographs were scanned by a scanner (CanoScan 600, Canon, Tokyo, Japan), and quantification was performed by computer with MacBAS software (Fuji Film, Tokyo, Japan).
Preparation of positive-control cDNAs of preproET-1 and GAPDH. The cDNAs for the verification of the semiquantitative PCR analysis were prepared from each gene PCR product of rat cDNA. Each PCR product was purified, quantified, and used as positive-control cDNAs.
Verification of the semiquantitative PCR analysis. We performed quantitative PCR analysis to evaluate the expression level of preproET-1 mRNA and GAPDH mRNA. To demonstrate that our quantitative PCR strategy was valid, serial dilutions of the each positive-control cDNA were amplified by PCR and quantified by scanner.
Statistics. Values are expressed as means ± SE. To evaluate differences between the sedentary control group and the exercise group, Student's t-test for unpaired values was used. P < 0.05 was accepted as significant.
| |
RESULTS |
|---|
|
|
|---|
There were no significant differences between the sedentary control group and the exercise group in systolic arterial pressure (123 ± 3 vs. 120 ± 3 mmHg) or heart rate (386 ± 17 vs. 385 ± 7 beats/min) on the day before death. There was no significant difference in body weight between the two groups (Table 1). Neither the kidney wet weight nor the lung wet weight differed significantly between the two groups (Table 1). These results indicated that the physical changes induced by 4 wk of training (familiarization with running on a treadmill) were of the same degree in the sedentary control group and the exercise group.
|
Immediately after the 45-min exercise or rest, the plasma concentrations of epinephrine and norepinephrine were significantly greater in the exercise group than in the sedentary control group (Fig. 1). Thus the plasma epinephrine concentration and the plasma norepinephrine concentration were increased by the acute exercise.
|
The relationships between the amount of cDNA and the yield of PCR products are shown in Fig. 2. As indicated in Fig. 2A, there was a linear correlation between the initial amount of preproET-1 cDNA and the yield of PCR products. In the case of GAPDH, the yield of PCR products was also in proportion to the initial amount of cDNA (Fig. 2B).
|
The expression of preproET-1 mRNA in the kidneys and lungs of both the sedentary control group and the exercise group was evaluated by RT-PCR analysis. The expression of GAPDH mRNA was also determined as an internal control. The expression of preproET-1 mRNA was markedly increased in the kidneys of the exercise group (Fig. 3). Therefore, the expression of preproET-1 mRNA in the kidneys was increased by the acute exercise. However, in the lungs, the expression of preproET-1 mRNA did not differ significantly between the two groups (Fig. 4). Therefore, the expression of preproET-1 mRNA in the lungs was not altered by the acute exercise.
|
|
The plasma concentration of ET-1 after acute exercise/rest was slightly but significantly higher in the exercise group than in the sedentary control group (Fig. 5). Therefore, the plasma ET-1 concentration was increased by the acute exercise.
|
| |
DISCUSSION |
|---|
|
|
|---|
In the present study, we determined preproET-1 mRNA expression in the lungs and kidneys of rats after acute exercise. The expression of preproET-1 mRNA in the kidneys was markedly higher in the exercise rats than in the sedentary control rats, whereas that in the lungs did not differ between the two groups. These findings suggested that the production of ET-1 was tissue specifically increased in the kidneys by acute exercise. It has been proposed that endogenously generated ET-1 contributes to basal vascular tone because it was found that the systemic administration of the endothelin-receptor antagonist TAK-044 significantly decreased systemic blood pressure and peripheral vascular resistance (8). Exercise results in a marked decrease in renal blood flow (6, 15, 33), whereas it increases cardiac output and pulmonary blood flow. On the basis of the results from past studies plus the present results, it was considered that the increased ET-1 production in the kidneys may cause the increase in vascular tone and the consequent decrease in blood flow in the kidneys, which are helpful in increasing blood flow in exercising muscles or in lungs, thereby contributing to the redistribution of blood flow during exercise. Such a decrease in renal blood flow would maximize the blood flow available to the active muscles.
The present study showed that the plasma concentrations of epinephrine and norepinephrine were far greater in the exercise rats than in the sedentary control rats, suggesting that sympathetic nerve activity was greatly augmented during acute exercise. In addition to the vasoconstrictor effect of ET-1, low concentrations of ET-1, which do not produce vasoconstriction, potentiate contractions to norepinephrine in arteries (37). It has also been demonstrated that a low dose of ET-1 enhances adrenergic vasoconstriction in perfused rat mesenteric arteries (32). Therefore, in blood vessels in the kidneys, it is possible that ET-1 potentiates norepinephrine-induced vasoconstriction. The increase in ET-1 in the kidneys may cause vasoconstriction through its direct action and/or by enhancing the vasoconstriction to norepinephrine and may contribute to the exercise-induced redistribution of blood flow.
In our previous study, the arteriovenous difference in the ET-1 concentration in nonworking muscles was significantly increased after exercise, whereas that in the working muscles was not significantly different before and after exercise (17). These findings suggested that the production of ET-1 was increased in the circulation of nonworking muscles by exercise. In that study, however, the following mechanism was also possible. During and immediately after exercise, the tissue blood flow in nonworking muscles may be decreased by vasoconstriction (3, 14). The reductions in blood flow could be mediated by sympathetic mechanisms and/or other vasoconstrictors (i.e., angiotensin II). When the local circulating blood flow is decreased, the level of local venous plasma ET-1 concentration could be elevated due to accumulation of ET-1 without an increase in endothelial ET-1 production. Therefore, it is possible that ET-1 was accumulated during exercise in the tissue of nonworking muscles because of a decreased blood flow and that the venous plasma concentration of ET-1 in the nonworking muscles was elevated after exercise by a washout effect. Accordingly, the increases in plasma ET-1 induced by exercise may not be due to the increases in ET-1 production and may be the result of decreases in blood flow to the various organs found in the gut and elsewhere. The most appropriate answer to this question would be provided from the direct measurement of preproET-1 mRNA expression in various tissue after exercise. The present study showed for the first time that preproET-1 mRNA expression in the internal organs is tissue specifically increased by exercise. The expression of preproET-1 mRNA in the kidneys was markedly higher in the exercise rats than in the sedentary control rats, suggesting that the production of ET-1 was actually increased in the kidney by acute exercise.
The mechanism underlying the difference in the production of ET-1 between the kidneys and lungs by exercise remains to be elucidated. It has been shown that both mechanical factors (such as hemodynamic shear stress) and neurohumoral factors (such as angiotensin II, arginine vasopressin, and so on) increase the production of ET-1 in cultured vascular endothelial cells (4, 28, 39). It has also been reported that low levels of shear stress stimulate and higher levels of shear stress depress the release of ET-1 in cultured vascular endothelial cells (10). The different alterations in blood flow between the kidneys and lungs by exercise (decrease and increase, respectively) might cause a difference in the levels of shear stress on vascular endothelial cells of the kidneys and lungs. Therefore, it is possible that a difference in the level of shear stress on vascular endothelial cells between the kidneys and lungs is one of the causal factors for the difference in ET-1 production seen in these organs. Because exercise increases cardiac output and hence greatly increases pulmonary blood flow, we chose to use the lung to represent active tissue during exercise. Alternatively, the following mechanism is also possible. It has been reported that NO and other vasodilating factors, such as prostacyclin, inhibit the production of ET-1 in vascular endothelium (27, 28). It also has been reported that hemodynamic shear stress increases production of NO from the vascular endothelium (2). Therefore, it is possible that NO or prostacyclin inhibits the production of ET-1 in the vascular endothelium of the lungs.
It has been reported that, in deoxycorticosterone acetate-salt hypertensive rats, the tissue ET-1 concentration in the vessels is higher than that in normotensive rats without a change in plasma ET-1 levels (11). Furthermore, we have reported that, in rats with cardiac hypertrophy due to aortic banding, tissue ET-1 concentration in the heart is higher than that in control sham-operated rats without a change in plasma ET-1 levels (38). These findings suggest that ET-1 plays a role in cardiovascular tissues as a local hormone, i.e., in an autocrine/paracrine fashion, rather than as a systemic hormone. Although increased levels of plasma ET-1 found in the present study are still below the concentration that causes pharmacological action reported by Yang et al. (37) and Tabuchi et al. (32), it is possible that an increase in local ET-1 levels around the vessels (especially around vascular smooth muscles) in the kidney by exercise is far greater than that in plasma.
We chose the present intensity and duration of exercise in rats on the basis of the following reasons. Laughlin and Armstrong (12) have shown that during treadmill locomotion blood flows increase at 15 m/min, a fast walk just below the transition to trotting for rats, in most active muscles. They also reported that most active muscles in rats showed gradual increases in blood flow that were linearly related to time from 5 through 54 min of low-intensity treadmill exercise (13). Furthermore, it has been demonstrated that treadmill running at 21.4 m/min (70 feet/min) or 30 m/min in rats results in a significant redistribution of tissue blood flow, in which blood flow is greatly increased in the active muscles and decreased in the kidney (6, 15). Therefore, we chose the present condition of treadmill running at 25 m/min for a duration of 45 min as exercise intensity and duration, which cause the redistribution of blood flow in rats.
The present study has the following study limitations. First, although it has been reported that changes in mature levels of ET-1 mainly originated from changes in preproET-1 mRNA expression (28), it is unclear whether the increase in preproET-1 mRNA in the kidney found in the present study contributes to an increase in mature peptide level of ET-1 in the kidney. Second, because changes in blood flow by exercise has been reported to be great in the kidney (6, 15, 33), we investigated expression of preproET-1 mRNA in this organ. However, although the decreases in blood flow during exercise occur in the stomach, spleen, liver, pancreas, and small and large intestines, we did not measure the expression of preproET-1 mRNA in these organs. Therefore, it is unclear whether the expression of preproET-1 mRNA in these organs is altered by exercise. Third, the plasma norepinephrine concentrations shown in Fig. 1 for sedentary control rats are excessively high compared with those found in the literature for awake, resting, nonrestrained rats (7). This could be due to the stress produced by the induction of anesthesia. In addition, plasma norepinephrine concentrations may or may not be indicative of sympathetic activation because plasma norepinephrine concentrations are the consequence of release and reuptake. Fourth, we expressed the level of preproET-1 mRNA relative to GAPDH as an internal control. To maximize the effectiveness of GAPDH as an internal control, preproET-1 and GAPDH should be coamplified in the same PCR reaction. However, the suitable cycles of amplification for preproET-1 with a linear correlation between the initial amount of cDNA and the yield of PCR products were different from that for GAPDH, presumably caused by the different levels of initial amount of each cDNA in each sample. Therefore, we performed the amplification of preproET-1 and GAPDH in separate PCR reactions by using same RT reaction.
In summary, we have demonstrated that the expression of preproET-1 mRNA in the kidneys was markedly higher in the exercise rats than in the sedentary control rats, whereas that in the lungs did not differ between the two groups. These findings suggest that the production of ET-1 was increased tissue specifically in the kidneys by exercise. The present study also demonstrated that the plasma norepinephrine concentrations were markedly elevated by exercise and, therefore, that the sympathetic nerve activity was greatly augmented during exercise. Therefore, the present study provides a possibility that the increase in the production of ET-1 in the kidneys may cause vasoconstriction and hence decrease blood flow in the kidneys via the direct vasoconstrictive action of ET-1 and/or an indirect effect of ET-1, enhancement of vasoconstriction to norepinephrine. Further studies as to whether the application of an endothelin-receptor antagonist affects the exercise-induced changes in blood flow are needed as more direct evidence to support this hypothesis, although the present data are consistent with this hypothesis. We propose that endogenous ET-1 participates in the exercise-induced changes in the distribution of blood flow by tissue-specific enhancement of ET-1 production in internal organs, which is helpful in increasing the blood flow to working muscles and to lungs.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by a grant-in-aid for scientific research from the Ministry of Education, Science, Sports and Culture of Japan (nos. 9780040 and 8670757).
| |
FOOTNOTES |
|---|
Address for reprint requests: T. Miyauchi, Cardiovascular Division, Dept. of Internal Medicine, Institute of Clinical Medicine, Univ. of Tsukuba, Tsukuba, Ibaraki 305-8575, Japan (E-mail: t-miyauc{at}md.tsukuba.ac.jp).
Received 8 December 1997; accepted in final form 3 April 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Armstrong, R. B.,
M. D. Delp,
E. F. Goljan,
and
M. H. Laughlin.
Distribution of blood flow in muscles of miniature swine during exercise.
J. Appl. Physiol.
62:
1285-1298,
1987
2.
Ayajiki, K.,
M. Kindermann,
M. Hecker,
I. Fleming,
and
R. Busse.
Intracellular pH and tyrosine phosphorylation but not calcium determine shear stress-induced nitric oxide production in native endothelial cells.
Circ. Res.
78:
750-758,
1996
3.
Blair, D. A.,
W. E. Glover,
and
I. C. Roddie.
Vasomotor responses in the human arm during leg exercise.
Circ. Res.
9:
264-274,
1961
4.
Emori, T.,
Y. Hirata,
K. Ohta,
K. Kanno,
S. Eguchi,
T. Imai,
M. Shichiri,
and
F. Marumo.
Cellular mechanism of endothelin-1 release by angiotensin and vasopressin.
Hypertension
18:
165-170,
1991
5.
Fixler, D. E.,
J. M. Atkins,
J. H. Mitchell,
and
L. D. Horwitz.
Blood flow to respiratory, cardiac, and limb muscles in dogs during graded exercise.
Am. J. Physiol.
231:
1515-1519,
1976.
6.
Flaim, S. F.,
W. J. Minteer,
D. P. Clark,
and
R. Zelis.
Cardiovascular response to aquatic and treadmill exercise in the untrained rat.
J. Appl. Physiol.
46:
302-308,
1979
7.
Geenen, D.,
P. Buttrick,
and
J. Scheuer.
Cardiovascular and hormonal responses to swimming and running in the rat.
J. Appl. Physiol.
65:
116-123,
1988
8.
Haynes, W. G.,
C. J. Ferro,
K. P. J. O'Kane,
D. Somerville,
C. C. Lomax,
and
D. J. Webb.
Systemic endothelin receptor blockade decreases peripheral vascular resistance and blood pressure in humans.
Circulation
93:
1860-1870,
1996
9.
Ignarro, L. J.
Biological action and properties of endothelium-derived nitric oxide formed and released from artery and vein.
Circ. Res.
65:
1-21,
1989
10.
Kuchan, M. J.,
and
J. A. Frangos.
Shear stress regulates endothelin-1 release via protein kinase C and cGMP in cultured endothelial cells.
Am. J. Physiol.
264 (Heart Circ. Physiol. 33):
H150-H156,
1993
11.
Larivière, R.,
G. Thibault,
and
E. L. Schiffrin.
Increased endothelin-1 content in blood vessels of deoxycorticosterone acetate-salt hypertensive but not in spontaneously hypertensive rats.
Hypertension
21:
294-300,
1993
12.
Laughlin, M. H.,
and
R. B. Armstrong.
Muscular blood flow distribution patterns as a function of running speed in rats.
Am. J. Physiol.
243 (Heart Circ. Physiol. 12):
H296-H306,
1982
13.
Laughlin, M. H.,
and
R. B. Armstrong.
Rat muscle blood flows as a function of time during prolonged slow treadmill exercise.
Am. J. Physiol.
244 (Heart Circ. Physiol. 13):
H814-H824,
1983
14.
Laughlin, M. H.,
and
R. B. Armstrong.
Muscle blood flow during locomotory exercise.
Exerc. Sports Sci. Rev.
13:
95-136,
1985.
15.
Laughlin, M. H.,
R. B. Armstrong,
J. White,
and
K. Rouk.
A method for using microspheres to measure muscle blood flow in exercising rat.
J. Appl. Physiol.
52:
1629-1635,
1982
16.
Maeda, S.,
T. Miyauchi,
K. Goto,
and
M. Matsuda.
Alteration of plasma endothelin-1 by exercise at intensities lower and higher than ventilatory threshold.
J. Appl. Physiol.
77:
1399-1402,
1994
17.
Maeda, S.,
T. Miyauchi,
M. Sakane,
M. Saito,
S. Maki,
K. Goto,
and
M. Matsuda.
Does endothelin-1 participate in the exercise-induced changes of blood flow distribution of muscles in humans ?
J. Appl. Physiol.
82:
1107-1111,
1997
18.
Miyauchi, T.,
T. Doi,
N. Suzuki,
M. Kakihana,
I. Yamaguchi,
Y. Sugishita,
T. Mitsui,
M. Hori,
T. Masaki,
and
K. Goto.
Plasma endothelin-1 concentrations in the coronary sinus in dogs with artificially induced myocardial infarction.
Peptides
13:
1013-1015,
1992[Medline].
19.
Miyauchi, T.,
M. Yanagisawa,
K. Iida,
R. Ajisaka,
N. Suzuki,
M. Fujino,
K. Goto,
T. Masaki,
and
Y. Sugishita.
Age- and sex-related variation of plasma endothelin-1 concentration in normal and hypertensive subjects.
Am. Heart J.
123:
1092-1093,
1992[Medline].
20.
Miyauchi, T.,
M. Yanagisawa,
T. Tomizawa,
Y. Sugishita,
N. Suzuki,
M. Fujino,
R. Ajisaka,
K. Goto,
and
T. Masaki.
Increased plasma concentrations of endothelin-1 and big endothelin-1 in acute myocardial infarction.
Lancet
2:
53-54,
1989[Medline].
21.
Musch, T. I.,
D. B. Friedman,
K. H. Pitetti,
G. C. Haidet,
J. Stray-Gundersen,
J. H. Mitchell,
and
G. A. Ordway.
Regional distribution of blood flow of dogs during graded dynamic exercise.
J. Appl. Physiol.
63:
2269-2277,
1987
22.
Musch, T. I.,
G. C. Haidet,
G. A. Ordway,
J. C. Longhurst,
and
J. H. Mitchell.
Training effects on regional blood flow response to maximal exercise in foxhounds.
J. Appl. Physiol.
62:
1724-1732,
1987
23.
Norton, K. I.,
M. T. Jones,
and
R. B. Armstrong.
Oxygen consumption and distribution of blood flow in rats climbing a laddermill.
J. Appl. Physiol.
68:
241-247,
1990
24.
Onizuka, M.,
T. Miyauchi,
K. Mitsui,
N. Suzuki,
T. Masaki,
K. Goto,
and
M. Hori.
Endothelin-1 mediates regional blood flow during and after pulmonary operations.
J. Thorac. Cardiovasc. Surg.
104:
1696-1701,
1992[Abstract].
25.
Palmer, R. M. J.,
A. G. Ferrige,
and
S. Moncada.
Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor.
Nature
327:
524-526,
1987[Medline].
26.
Peuler, J. D.,
and
G. A. Johnson.
Simultaneous single isotope radioenzymatic assay of plasma norepinephrine, epinephrine and dopamine.
Life Sci.
21:
625-636,
1977[Medline].
27.
Prins, B. A.,
R. M. Hu,
B. Nazario,
A. Pedram,
H. J. L. Frank,
M. A. Weber,
and
E. R. Levin.
Prostaglandin E2 and prostacyclin inhibit the production and secretion of endothelin from cultured endothelial cells.
J. Biol. Chem.
269:
11938-11944,
1994
28.
Rubanyi, G. M.,
and
M. A. Polokoff.
Endothelins: molecular biology, biochemistry, pharmacology, physiology, and pathophysiology.
Pharmacological Reviews
46:
325-415,
1994[Medline].
29.
Sakai, S.,
T. Miyauchi,
M. Kobayashi,
I. Yamaguchi,
K. Goto,
and
Y. Sugishita.
Inhibition of myocardial endothelin pathway improves long-term survival in heart failure.
Nature
384:
353-355,
1996[Medline].
30.
Sakurai, T.,
M. Yanagisawa,
A. Inoue,
U. S. Ryan,
S. Kimura,
Y. Mitsui,
K. Goto,
and
T. Masaki.
cDNA cloning, sequence analysis and tissue distribution of rat preproendothelin-1 mRNA.
Biochem. Biophys. Res. Commun.
175:
44-47,
1991[Medline].
31.
Shen, W.,
M. Lundborg,
J. Wang,
J. M. Stewart,
X. Xu,
M. Ochoa,
and
T. H. Hintze.
Role of EDRF in the regulation of regional blood flow and vascular resistance at rest and during exercise in conscious dogs.
J. Appl. Physiol.
77:
165-172,
1994
32.
Tabuchi, Y.,
M. Nakamaru,
H. Rakugi,
M. Nagano,
and
T. Ogihara.
Endothelin enhances adrenergic vasoconstriction in perfused rat mesenteric arteries.
Biochem. Biophys Res. Commun.
159:
1304-1308,
1989[Medline].
33.
Tidgren, B.,
P. Hjemdahl,
E. Theodorsson,
and
J. Nussberger.
Renal neurohormonal and vascular responses to dynamic exercise in humans.
J. Appl. Physiol.
70:
2279-2286,
1991
34.
Tso, J. Y.,
X. H. Sun,
T. H. Kao,
K. S. Reece,
and
R. Wu.
Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene.
Nucleic Acids Res.
13:
2485-2502,
1985
35.
Van Citters, R. L. V.,
and
D. Franklin.
Cardiovascular performance of Alaska sled dogs during exercise.
Circ. Res.
24:
33-42,
1969
36.
Yanagisawa, M.,
H. Kurihara,
S. Kimura,
Y. Tomobe,
M. Kobayashi,
Y. Mitsui,
Y. Yazaki,
K. Goto,
and
T. Masaki.
A novel potent vasoconstrictor peptide produced by vascular endothelial cells.
Nature
332:
411-415,
1988[Medline].
37.
Yang, Z.,
V. Richard,
L. Segesser,
E. Bauer,
P. Stulz,
M. Turina,
and
T. F. Luscher.
Threshold concentrations of endothelin-1 potentiate contractions to norepinephrine and serotonin in human arteries. A new mechanism of vasospasm?
Circulation
82:
188-195,
1990
38.
Yorikane, R.,
S. Sakai,
T. Miyauchi,
T. Sakurai,
Y. Sugishita,
and
K. Goto.
Increased production of endothelin-1 in the hypertrophied rat heart due to pressure overload.
FEBS Lett.
332:
31-34,
1993[Medline].
39.
Yoshizumi, M.,
H. Kurihara,
T. Sugiyama,
F. Takaku,
M. Yanagisawa,
T. Masaki,
and
Y. Yazaki.
Hemodynamic shear stress stimulates endothelin production by cultured endothelial cells.
Biochem. Biophys. Res. Commun.
161:
859-864,
1989[Medline].
This article has been cited by other articles:
![]() |
K. Aizawa, M. Iemitsu, T. Otsuki, S. Maeda, T. Miyauchi, and N. Mesaki Sex differences in steroidogenesis in skeletal muscle following a single bout of exercise in rats J Appl Physiol, January 1, 2008; 104(1): 67 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Moraes, G. Gioseffi, A. C. L. Nobrega, and E. Tibirica Effects of exercise training on the vascular reactivity of the whole kidney circulation in rabbits J Appl Physiol, August 1, 2004; 97(2): 683 - 688. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Maeda, T. Miyauchi, M. Iemitsu, T. Tanabe, K. Goto, I. Yamaguchi, and M. Matsuda Endothelin receptor antagonist reverses decreased NO system in the kidney in vivo during exercise Am J Physiol Endocrinol Metab, April 1, 2004; 286(4): E609 - E614. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Merkus, B. Houweling, A. Mirza, F. Boomsma, A. H van den Meiracker, and D. J Duncker Contribution of endothelin and its receptors to the regulation of vascular tone during exercise is different in the systemic, coronary and pulmonary circulation Cardiovasc Res, September 1, 2003; 59(3): 745 - 754. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Miyauchi, S. Maeda, M. Iemitsu, T. Kobayashi, Y. Kumagai, I. Yamaguchi, and M. Matsuda Exercise causes a tissue-specific change of NO production in the kidney and lung J Appl Physiol, January 1, 2003; 94(1): 60 - 68. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Iemitsu, T. Miyauchi, S. Maeda, T. Tanabe, M. Takanashi, Y. Irukayama-Tomobe, S. Sakai, H. Ohmori, M. Matsuda, and I. Yamaguchi Aging-induced decrease in the PPAR-alpha level in hearts is improved by exercise training Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H1750 - H1760. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Maeda, T. Miyauchi, M. Iemitsu, T. Tanabe, Y. Irukayama-Tomobe, K. Goto, I. Yamaguchi, and M. Matsuda Involvement of Endogenous Endothelin-1 in Exercise-Induced Redistribution of Tissue Blood Flow: An Endothelin Receptor Antagonist Reduces the Redistribution Circulation, October 22, 2002; 106(17): 2188 - 2193. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takamura, R. Parent, P. Cernacek, and M. Lavallee Influence of dual ETA/ETB-receptor blockade on coronary responses to treadmill exercise in dogs J Appl Physiol, November 1, 2000; 89(5): 2041 - 2048. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sakai, T. Miyauchi, and I. Yamaguchi Long-Term Endothelin Receptor Antagonist Administration Improves Alterations in Expression of Various Cardiac Genes in Failing Myocardium of Rats With Heart Failure Circulation, June 20, 2000; 101(24): 2849 - 2853. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ueno, T. Miyauchi, S. Sakai, T. Kobayashi, K. Goto, and I. Yamaguchi Effects of physiological or pathological pressure load in vivo on myocardial expression of ET-1 and receptors Am J Physiol Regulatory Integrative Comp Physiol, November 1, 1999; 277(5): R1321 - R1330. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Wu-Wong, C. E. Berg, J. Wang, W. J. Chiou, and B. Fissel Endothelin Stimulates Glucose Uptake and GLUT4 Translocation via Activation of Endothelin ETA Receptor in 3T3-L1 Adipocytes J. Biol. Chem., March 19, 1999; 274(12): 8103 - 8110. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |