Journal of Applied Physiology Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Appl Physiol 105: 1218-1227, 2008. First published July 31, 2008; doi:10.1152/japplphysiol.00997.2007
8750-7587/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
105/4/1218    most recent
00997.2007v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Branvold, D. J.
Right arrow Articles by Winder, W. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Branvold, D. J.
Right arrow Articles by Winder, W. W.

Thyroid hormone effects on LKB1, MO25, phospho-AMPK, phospho-CREB, and PGC-1{alpha} in rat muscle

D. J. Branvold, D. R. Allred, D. J. Beckstead, H. J. Kim, N. Fillmore, B. M. Condon, J. D. Brown, S. N. Sudweeks, D. M. Thomson, and W. W. Winder

Department of Physiology and Developmental Biology, Brigham Young University, Provo, Utah

Submitted 19 September 2007 ; accepted in final form 29 July 2008


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Expression of all of the isoforms of the subunits of AMP-activated protein kinase (AMPK) and AMPK activity is increased in skeletal muscle of hyperthyroid rats. Activity of AMPK in skeletal muscle is regulated principally by the upstream kinase, LKB1. This experiment was designed to determine whether the increase in AMPK activity is accompanied by increased expression of the LKB1, along with binding partner proteins. LKB1, MO25, and downstream targets were determined in muscle extracts in control rats, in rats given 3 mg of thyroxine and 1 mg of triiodothyronine per kilogram chow for 4 wk, and in rats given 0.01% propylthiouracil (PTU; an inhibitor of thyroid hormone synthesis) in drinking water for 4 wk (hypothyroid group). LKB1 and MO25 increased in the soleus of thyroid hormone-treated rats vs. the controls. In other muscle types, LKB1 responses were variable, but MO25 increased in all. In soleus, MO25 mRNA increased with thyroid hormone treatment, and STRAD mRNA increased with PTU treatment. Phospho-AMPK and phospho-ACC were elevated in soleus and gastrocnemius of hyperthyroid rats. Thyroid hormone treatment also increased the amount of phospho-cAMP response element binding protein (CREB) in the soleus, heart, and red quadriceps. Four proteins having CREB response elements (CRE) in promoter regions of their genes (peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha}, uncoupling protein 3, cytochrome c, and hexokinase II) were all increased in soleus in response to thyroid hormones. These data provide evidence that thyroid hormones increase soleus muscle LKB1 and MO25 content with subsequent activation of AMPK, phosphorylation of CREB, and expression of mitochondrial protein genes having CRE in their promoters.

adenosine 5'-monophosphate-activated protein kinase; acetyl-coenzyme A carboxylase; muscle mitochondria


EXPERIMENTAL HYPERTHYROIDISM has previously been demonstrated to increase mitochondrial enzyme content of rat skeletal muscle and other tissues (48, 49). Rat soleus muscle, consisting predominantly of type I, slow-twitch fibers, is much more sensitive than other muscles to this action of thyroid hormones (3, 48), possibly due to increased thyroid hormone receptor expression (3). This model has been used to study some of the basic molecular signaling pathways responsible for this effect of thyroid hormone excess on mitochondrial biogenesis (18, 19, 33). Hyperthyroidism is one of relatively few conditions that increases metabolic rate and increases expression of mitochondrial proteins in skeletal muscle. Previous studies suggest that the LKB1/AMP-activated protein kinase (AMPK) signaling pathway is important in mitochondrial biogenesis (47, 53). In this present study, the adaptation of the LKB1/AMPK signaling pathway to hypo- and hyperthyroidism was investigated, along with downstream targets regulated by this pathway.

AMPK acts as a fuel gauge for the cell, responding to changes in cellular energy (13, 50). AMPK is activated during exercise, ischemia, hypoxia, and other forms of cellular stress (37). AMPK is inactive until phosphorylated by an upstream kinase at the threonine 172 site of the {alpha}-subunit (40, 45). Although other kinases [CaMKK-β and transforming growth factor-β activated kinase (TAK1)] can phosphorylate AMPK, a protein complex including LKB1 appears to be the major upstream kinase for AMPK in skeletal muscle (14, 20, 22, 36, 45, 47). In other cells and tissues, optimal phosphorylation/activation of AMPK by LKB1 requires association of LKB1 with STRAD and MO25 (1, 4, 15). Evidence has been presented for a role of CaMKK-β at the onset of mild tetanic contractions (20) and a role for CaMKK-{alpha}, CaMKK-β, and possibly TAK1 during overload-induced hypertrophy (28). Expression and activity of CaMKK-{alpha} and CaMKK-β, as well as phosphorylation of TAK1, were found to increase manyfold in response to muscle overload (28), implying that calcium-triggered activation of AMPK may play a more important role in hypertrophied muscle.

A previous study in this laboratory (33) demonstrated that all of the subunits of AMPK were increased in skeletal muscle with thyroid hormone treatment, especially in the soleus and red quadriceps. An increase in both acetyl-CoA carboxylase (ACC) protein content and phosphorylation was also observed. At this point, however, the AMPKK complex had not yet been characterized. We, therefore, designed an experiment to test the hypothesis that thyroid hormone treatment would increase the expression of LKB1, STRAD, and MO25.

We also were interested in studying effects of novel downstream targets of the LKB1/AMPK signaling pathway that could be influenced by thyroid state. Peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}) is a transcriptional regulator for genes involved in mitochondrial biogenesis, fatty acid oxidation, and gluconeogenesis (35). Skeletal muscle-specific LKB1 knockout mice show a decrease in PGC-1{alpha}, as well as mitochondrial proteins (47). Irrcher et al. (18) found that PGC-1{alpha} expression increased in skeletal muscle after 5 days of thyroid hormone treatment, with the largest increase occurring in the soleus.

Cyclic AMP response element binding protein (CREB) is a well-characterized transcription factor activated by various stimuli (39). It was originally discovered as a downstream target of the cAMP pathway. CREB is activated by phosphorylation at the serine 133 position (7, 12). CREB is involved in a variety of cellular processes, such as proliferation, development, and differentiation. It is also involved in regulation of hepatic gluconeogenesis by glucagon and epinephrine (12, 39). Recent experiments in our laboratory showed that AMPK and PKA both phosphorylate CREB at the serine 133 position (46). The promoter region of the PGC-1{alpha} gene, as well as other thyroid hormone-responsive genes of proteins involved in ATP production, contain CREB response elements (CREs). Thus it is possible that enhanced phosphorylation of CREB by AMPK could mediate some effects of thyroid hormone on expression of these genes. We hypothesized that CREB phosphorylation would increase in skeletal muscle in thyroid hormone-treated rats.

We hypothesized that the hyperthyroid condition would result in chronic activation of AMPK due to the increase in energy demand and oxygen consumption, even at rest. The chronic AMPK activation would result in increased CREB phosphorylation and PGC-1{alpha} expression. Expression of proteins with CREs in promoters of their genes would be expected to increase. We also expected to see greater absolute AMPK activation in the hyperthyroid muscle during times of muscle contraction when energy demand is markedly increased. Under these conditions, the AMPK activity would be predicted to be higher in the hyperthyroid state due to increased expression of AMPK subunits and possibly to increased expression of components of the upstream kinase(s).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animal care.   All procedures were approved by the Institutional Animal Care and Use Committee of Brigham Young University. Male Sprague-Dawley rats (Sasco, Wilmington, MA) were housed in individual cages in a room lighted from 6 AM to 6 PM. Rats weighed an average of 107 ± 20 g at the beginning of treatments. Rats were divided into three treatment groups. The first group [control (Cntrl)] received normal rodent diet (Harlan Teklad rodent diet, Madison, WI) and water ad libitum. The second group [hypothyroid (Hypo)] received normal rodent diet and 0.01% propylthiouracil (PTU) in drinking water for 4 wk for the purpose of inhibiting thyroid hormone synthesis. The third group [hyperthyroid (Hyper)] was provided with powdered Harlan Teklad rodent diet containing 3 mg of thyroxine and 1 mg of 3,5,3'-triiodothyronine per kilogram for 4 wk. These dosages have been used previously in studies on muscle mitochondrial biogenesis and are well tolerated by the rats (48, 49). On the afternoon before the rats were killed, they were given 20 g of either normal rodent diet (Cntrl and Hypo) or powdered rodent diet containing thyroid hormones (Hyper).

Muscle stimulation, collection, and homogenization.   Rats were anesthetized with pentobarbital sodium (0.08 mg/g body wt) at least 30 min before beginning the procedure. The right soleus and gastrocnemius were isolated and frozen using aluminum block tongs at liquid nitrogen temperature. The left tibial nerve was isolated and stimulated at a frequency of 1/s, 10-ms duration, 15 V, for 5 min. The left gastrocnemius and soleus were then removed and clamp frozen. The red and white quadriceps, heart, and liver were also removed at this time. Plasma was collected for analysis of thyroid hormones using ELISA kits (BioQuant, San Diego, CA). Tissues were kept frozen at –95°C until analyses. The retroperitoneal fat pads were weighed as an indicator of adiposity. Muscles were weighed and then homogenized in 9 or 19 (soleus) volumes of homogenization buffer (50 mM Tris·HCl, 250 mM mannitol, 50 mM NaF, 5 mM sodium pyrophosphate, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 1 mM benzamidine, 0.1 mM phenylmethanesulfonyl fluoride, and 5 µg/ml soybean trypsin inhibitor; pH 7.4). The homogenates were centrifuged at 1,200 g for 5–10 min at 4°C, and the supernatants were kept for analysis.

AMPK activity and LKB1 activity.   The {alpha}1- and {alpha}2-AMPK activities were determined on immunoprecipitates from soleus homogenates, as described previously (32). LKB1 was immunoprecipitated from 120 µl of soleus homogenate using 4.5 µl (packed volume) Protein G Sepharose linked to 3.5 µg LKB1 antibody (sc-5640, Santa Cruz Biotechnology). Immunoprecipitates were washed twice with homogenization buffer + 0.5 M NaCl, then twice with 40 mM HEPES, 80 mM NaCl, 8% glycerol, 0.8 mM EDTA, 5 mM MgCl2, and 0.8 mM DTT (pH 7). Immunoprecipitated LKB1 activity toward LKBtide (LSNLYHQGKFLQTFCGSPLYRRR) was then assessed in a 50-µl reaction volume consisting of 40 mM HEPES, 80 mM NaCl, 8% glycerol, 0.8 mM EDTA, 0.8 mM DTT, 5 mM MgCl2, 0.2 mM ATP, 0.2 mM LKBtide, and 5–10 µCi [{gamma}-32P]ATP, and incubated for 15 min at 30°C with continuous shaking. After the reaction period, 40 µl of the reaction volume were spotted to P81 papers and washed four times (15 min each) in 1% phosphoric acid. The papers were rinsed with distilled water and then acetone and dried, and the radioactivity incorporated into LKBtide was assessed by scintillation counting.

Western blotting and immunodetection.   Homogenates were diluted in sample loading buffer (50 mM Tris·HCl, pH 6.8, 10% glycerol, 2% SDS, 2% β-mercaptoethanol, and 0.1% bromphenol blue) and loaded (4 µl homogenate) on 5% [ACC, phospho (p)-ACC, PGC-1], 7.5% (p-AMPK, PGC-1, LKB1), and 10% [p-CREB, CREB, MO25, protein phosphatase 2C (PP2C), ERK1/2] Tris·HCl gels (Bio-Rad Criterion System, Hercules, CA). Electrophoresis was applied for 53 min at 200 V, after which the proteins were transferred to polyvinylidene difluoride membranes at 100 V for 1 h. Membranes were stained with Ponceau S to ensure even transfer and protein loading across lanes, then washed in Tris-buffered saline plus Tween (TBST), blocked for 1 h at room temperature in 5% nonfat dry milk in TBST, and probed overnight at 4°C with primary antibody diluted in 1% BSA dissolved in TBST. Commercially available antibodies and dilutions were as follows: p-ACC, p-AMPK, AMPK-{alpha} (1:750, 1:1,000, and 1:1,000, respectively; Cell Signaling Technology, Beverly, MA); cytochrome c, hexokinase II (1:15,000 and 1:8,000, respectively; Santa Cruz Biotechnology, Santa Cruz, CA); uncoupling protein 3 (UCP3), MO25 (1:2,000 and 1:20,000, respectively; MO25 Custom made, Affinity Bioreagents, Golden, CO); CREB, PP2C-{alpha}/β, and PGC-1 (1:5,000, 1:4,000, and 1:1,000, respectively; Chemicon International, Temecula, CA); and LKB1, p-CREB, and MAP kinase 1/2 (ERK1/2) (1:5,000, 1:2,000, and 1:5,000, respectively; Upstate, Lake Placid, NY). Total ACC was detected with a streptavidin-horseradish peroxidase conjugate (GE Healthcare, Piscataway, NJ). The MO25 antibody was commercially prepared in rabbits by injection of a keyhole limpet hemocyanin conjugate of a peptide (mpfpfgkshkspad) corresponding to the first 14 amino acids on the NH2-terminal of human and rat MO25. Although not identical, the {alpha}- and β-isoforms of MO25 have similar amino acid sequences in this region (4). The MO25-{alpha} isoform is expressed in skeletal muscle (4). After primary antibody incubation, the membranes were washed in TBST and incubated for 1 h at room temperature in horseradish peroxidase-conjugated secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) diluted in 1% nonfat dry milk in TBST. Membranes were again washed in TBST and then covered with enhanced chemiluminescence Western blotting detection reagent (GE Healthcare Biosciences) for 1 min. HRP activity was then detected using autoradiographic film (Classic Blue Sensitive; Midwest Scientific, St. Louis, MO). Relative band intensity was quantified using the Spot Denso function of AlphaEaseFC software (Alpha Innotech, San Leandro, CA).

Coimmunoprecipitation of LKB1 and MO25.   Coimmunoprecipitation of MO25 and LKB1 was performed as follows. One and one-half micrograms of LKB1 antibody (sc-5640, Santa Cruz Biotechnology) were linked to 8 µl (packed volume) ExactaCruz C IP matrix (Santa Cruz Biotechnology) for 2 h at 4°C. The matrix was washed three times with ice-cold phosphate-buffered saline. Sixty microliters of clarified soleus homogenate were rotated end over end overnight with the antibody-matrix complex at 4°C. The LKB1 immunoprecipitates were then washed three times with homogenization buffer and then resuspended in 75 µl of 1x loading buffer (with 2.5% β-mercaptoethanol). Samples were boiled for 5 min, then 25 µl of sample per well were loaded onto 7.5% (for LKB1) and 10% (for MO25) Tris·HCl gels (Bio-Rad Criterion System, Hercules, CA), and Western blotting/immunodetection was performed as described above using primary antibodies for LKB1 (1:5,000, Upstate no. 07-694) and MO25 (1:50,000, described above) and a secondary antibody (1:5,000, Rabbit ExactaCruz C-HRP, Santa Cruz Biotechnology).

Real-time PCR.   Relative changes in mRNA with thyroid status were examined by real-time PCR. Total mRNA was isolated from 20–30 mg of tissue from Cntrl, Hyper, and Hypo rats with the RNeasy fibrous tissue kit (Qiagen), according to the manufacturer's instructions. Samples were homogenized with an Ultra-Turrax T8 (IKA, Wilmington, NC). cDNA libraries for each sample were generated using the SuperScript III first-strand synthesis kit (Invitrogen), according to the manufacturer's instructions. Real-time PCR using gene-specific primers for LKB1, MO25, and STRAD mRNA and 18S rRNA was performed, using the Platinum SYBR Green qPCR Supermix UDG kit (Invitrogen) with an ABI-7000 real-time PCR System. Primers (Invitrogen) were as follows: LKB1 forward, AGAGGAAGTGGGTCAGAATGGA; LKB1 reverse, CCGGCCTTCTGGCTTCA; MO25 forward, GGTTGCCATGAAAGAAATTCTGT; MO25 reverse, AGCTGTGCTACGGCCTCTGT; STRAD forward, TCCGAGGCTTTACCTGAGTTG; STRAD reverse, AGACTGGCTGCCCTCGAA; 18S forward, GTGCATGGCCGTTCTTAGTTG; and 18S reverse, GCCACTTGTCCCTCTAAGAAGTTG. Samples were amplified in triplicate. Amplification protocol was 50°C for 2 min and 95°C for 10 min, and then 60 cycles of 95°C for 15 s, 60°C for 20 s, and 72°C for 30 s. For postamplification dissociation to generate melting curves, temperature was raised from 60 to 95°C. Cycle threshold (CT) was calculated automatically by the ABI software. Relative fold expression was calculated using the 2Formula method after normalizing to 18S RNA (24).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Evidence of hyper- and hypothyroid conditions.   Final body weights for both Hyper and Hypo rats were significantly less than that for the Cntrl (P < 0.05) (Table 1). As evidence that the PTU was indeed inhibiting thyroid hormone production, there was marked hypertrophy of the thyroid in Hypo rats (Table 1). The fat pad weights for Hyper and Hypo rats were both significantly less than for the Cntrl, and the fat pad weight of Hyper rats was significantly less than that for both Cntrl and Hypo rats (P < 0.05) (Table 1). The heart weights for the Hyper rats were significantly greater (P < 0.05) than for Cntrl or Hypo rats, whether expressed as absolute weight or relative to body weight (Table 1). During the last week before the animals were killed, the average daily food intake was ~50% greater for Hyper and 25% less for Hypo than for Cntrl rats. Plasma triiodothyronine and thyroxine concentrations were decreased markedly in Hypo rats and increased significantly in Hyper rats (Table 1).


View this table:
[in this window]
[in a new window]

 
Table 1. Evidence of hyper- and hypothyroidism

 
LKB1, STRAD, and MO25 Western blot in skeletal muscle.   LKB1 and MO25 migrated in the gel to the approximate positions based on their molecular mass (LKB1 at 55 kDa and MO25 at 40 kDa). In a previous study, our laboratory reported MO25 as a 55-kDa band on our gels (44). We attributed this higher molecular mass band to expression of a splice variant in skeletal muscle, but have subsequently been unsuccessful in obtaining evidence for splice variations in mRNA from muscle. Although the 55-kDa band may indeed be a covalently modified variant of MO25, we have reported the 40-kDa band in the present experiments. Figure 1 shows that LKB1 and MO25 were present in significantly higher amounts (150 and 160% of Cntrl values, respectively) in the Hyper rats than in Cntrl rats in soleus muscle (P < 0.05). In heart, red quadriceps, white quadriceps, and gastrocnemius muscle, MO25 expression increased to ~140, 150, 125, and 210% of Cntrl values, respectively, in the Hyper rats (P < 0.05). LKB1 response to altered thyroid hormone status varied among the different muscle types (see Table 2). ERK1/2 were also measured to determine whether this increase in expression of the LKB1/AMPK proteins was part of a generalized increase in protein synthesis. ERK2 expression was not significantly influenced by the treatments, and ERK1 was actually decreased in Hyper soleus muscle compared with Cntrl (–44%) (data not shown).


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 1. Relative expression of soleus muscle LKB1 and MO25 in control (Cntrl), thyroid hormone-treated [hyperthyroid (Hyper)], and propylthiouracil (PTU)-treated [hypothyroid (Hypo)] rats, determined by Western blot. LKB1 expression in Hyper and Hypo rats was significantly different from Cntrl, and MO25 expression in Hyper rats was significantly higher than in Cntrl. Values are means ± SE; n = 9. *Significantly different from control, P < 0.05.

 

View this table:
[in this window]
[in a new window]

 
Table 2. LKB1 and MO25 protein expression in heart and skeletal muscle

 
Immunoprecipitation studies.   Figure 2 shows that immunoprecipitated LKB1 was higher in soleus muscle of the Hyper rats compared with Cntrl, similar to the magnitude of the increase seen in Western blots of supernatants of whole homogenates. MO25 was also detected in the LKB1 immunoprecipitates. MO25 in the immunoprecipitates from Cntrl, Hyper, and Hypo rats also occurred in approximately the same ratio as was seen in the crude homogenates. Only the 40-kDa band was observed in the immunoprecipitates. LKB1 activity of immunoprecipitates showed the same pattern as the LKB1 and MO25 Western blots.


Figure 2
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 2. Western blots of LKB1 and MO25, and LKB1 activity in LKB1 immunoprecipitates (IP) from soleus muscles of Cntrl, Hyper, and Hypo rats. Values are means ± SE; n = 5–7. *Significantly different from control, P < 0.05. Due to interassay variation, LKB1 activity is expressed as percentage of control. The average LKB1 activity in soleus muscles from Cntrl rats was 4.0 ± 1.2 pmol·g–1·min–1.

 
AMPK activity, p-ACC, and p-AMPK Western blot in resting and stimulated skeletal muscle.   A previous study showed that both ACC and p-ACC increase in skeletal muscle due to thyroid hormone treatment (12). To test whether thyroid hormone treatment would increase the amount of AMPK phosphorylation, as well as activation, as shown by the subsequent phosphorylation of ACC, we stimulated the left tibial nerve for 5 min. Both gastrocnemius and soleus muscles showed an increase in both p-AMPK and p-ACC in Hyper under resting conditions compared with Cntrl (see Figs. 3 and 4). In the gastrocnemius, p-AMPK increased in response to stimulation in Cntrl, Hyper, and Hypo rats. Stimulated values were not different in the three groups. However, p-ACC, the downstream target of AMPK, was higher both at rest and after 5-min stimulation in the Hyper group (Fig. 3). In the soleus, the {alpha}2-AMPK activity was higher in the Hyper group at rest and after electrical stimulation (Fig. 4). The {alpha}1-AMPK activity was not significantly different at rest but was higher in the Hyper group after stimulation. Although the AMPK activity and p-AMPK in soleus of Cntrl rats were not influenced by electrical stimulation, p-ACC was increased, indicating the p-AMPK fraction in the contracting muscle was probably allosterically activated by the increase in AMP.


Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 3. Effect of 5-min electrical stimulation (Stim) on increase in phosphorylation of acetyl-CoA carboxylase (p-ACC) and on phospho-AMP-activated protein kinase (p-AMPK) in gastrocnemius of Cntrl, Hyper, and Hypo rats. Values are means ± SE; n = 7–9. *Significantly different from resting muscle of the same treatment, P < 0.05. {dagger}Significantly different from Cntrl rest or Cntrl Stim, P < 0.05.

 

Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 4. AMPK activity (n = 5) of IPs and Western blots of p-AMPK (phospho-threonine-172) and p-ACC (n = 7–9) in resting and electrically stimulated soleus muscles. Values are means ± SE. *Significantly different from resting muscle of the same treatment group, {dagger}Significantly different from Cntrl rest or Cntrl Stim, P < 0.05.

 
The total {alpha}-subunit content and total ACC measured by Western blot were increased in muscle of the Hyper rats. Relative values for soleus total AMPK-{alpha} were 100 ± 6 for Cntrl, 132 ± 6 for Hyper (significant difference from both groups, P < 0.05), and 95 ± 6 for Hypo. Relative values for total ACC in soleus were 100 ± 10 for Cntrl, 180 ± 12 for Hyper (significant difference from both groups, P < 0.05), and 79 ± 14 for Hypo. For gastrocnemius, total AMPK-{alpha} was 100 ± 5 for Cntrl, 131 ± 9 for Hyper (significant difference from both groups, P < 0.05), and 90 ± 5 for Hypo. Relative values for total ACC in gastrocnemius were 100 ± 10 for Cntrl, 124 ± 7 for Hyper (significant difference from the Hypo group only, P < 0.05), and 89 ± 10 for Hypo.

In the heart, relative values of p-AMPK were 100 ± 11, 140 ± 12, and 64 ± 6 for Cntrl, Hyper, and Hypo rats, respectively. The Cntrl values may have been inordinately high due to the fact that the heart was removed last, shortly after blood collection and was, therefore, likely hypoxic at the time of collection. Nevertheless, statistically significant differences were noted between all treatment groups (P < 0.05).

PP2C Western blot.   PP2C was not significantly influenced in soleus muscle by thyroid state. Values were 100 ± 7 for Cntrl, 77 ± 13 for Hyper, and 87 ± 11 for Hypo (n = 5).

CREB and PGC-1{alpha} Western blot in muscle.   CREB protein expression decreased by 20% in heart muscle in Hypo rats compared with the other groups. CREB did not change among the treatment groups for the other muscle types. Figure 5 shows that PGC-1{alpha} expression was 50% higher in the soleus of Hyper rats than Cntrl rats (P < 0.05), but it was not significantly changed in Hypo rats. There was no significant change in any of the other muscle types (data not shown).


Figure 5
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 5. Relative expression of peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}) in soleus homogenates of Cntrl, Hyper, and Hypo rats was determined by Western blot. Values are means ± SE; n = 9. *Significantly different from control, P < 0.05.

 
p-CREB Western blot in resting and stimulated muscle.   Under resting conditions, p-CREB levels were significantly higher in Hyper rats in the heart, red quadriceps, and soleus (70, 40, and 120% higher than Cntrl, respectively) than in the Cntrl rats (see Fig. 6). Upon electrical stimulation, however, a 50% increase occurred in soleus, and a twofold increase in CREB phosphorylation occurred in the gastrocnemius of the Hyper rats. (Fig. 7). In Cntrl and Hypo rats, there was no significant increase in p-CREB upon stimulation (Fig. 7).


Figure 6
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 6. p-cAMP response element binding protein (p-CREB) (Ser 133) in heart, red quadriceps (Quad), and soleus muscles of Cntrl, Hyper, and Hypo rats. Values are means ± SE; n = 9. *Significantly different from control, P < 0.05.

 

Figure 7
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 7. Effect of 5-min electrical stimulation on p-CREB (Ser 133) in soleus and gastrocnemius muscle of Cntrl, Hyper, and Hypo rats. Values are means ± SE; n = 5 for soleus and 9 for gastrocnemius. *Significantly different from control, P < 0.05. Hypo significantly different from Hyper in both muscles, P < 0.05.

 
Expression of proteins coded by genes having CREs in their promoters.   Cytochrome c, UCP3, and hexokinase II were all significantly increased in soleus muscle in response to thyroid hormone treatment (Table 3). Each of these proteins was higher in the Hyper rats than in either the Cntrl or Hypo rats. Cytochrome c and UCP3 were significantly reduced in Hypo rats compared with Cntrl, and a trend was noted in hexokinase II. UCP3 fluctuated most markedly as a function of thyroid status.


View this table:
[in this window]
[in a new window]

 
Table 3. Soleus muscle expression of three proteins coded by genes with cAMP response element binding protein response elements in their promoters

 
LKB1, STRAD, and MO25 mRNA expression.   Relative levels of LKB1, STRAD, and MO25 mRNA were measured in the soleus of Cntrl, Hypo, and Hyper rats. LKB1 mRNA levels did not change with thyroid hormone or PTU treatment (data not shown). STRAD mRNA did not increase with thyroid hormone treatment, but, surprisingly, it increased to 145 ± 13% of the Cntrl with PTU treatment (P < 0.05). MO25 mRNA was 165 ± 20% of the Cntrl with thyroid hormone treatment (P < 0.05).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A previous study from this laboratory (33) showed that AMPK is regulated, at least in part, by thyroid hormone. All isoforms of the subunits of AMPK were influenced by thyroid hormone and PTU treatment. The elevated AMPK phosphorylation in the Hyper rats was likely due in part to the increased expression of AMPK subunits, as shown in the present study and in our laboratory's previous study (33). LKB1 and associating binding partner proteins were not characterized as an AMPKK until 2003 (4, 15), and it was, therefore, impossible at the time of the study by Park et al. (33) to determine the effect of thyroid hormone on LKB1, STRAD, and MO25. It seemed likely that the expression of these proteins would increase in response to thyroid hormone treatment, similar to the increase in AMPK subunits. This proved to be the case, although the increase in LKB1 and MO25 seemed more tissue dependent than the changes in AMPK subunit expression. LKB1 and MO25 increased significantly in the soleus of Hyper rats. MO25 increased significantly in all other tissue types analyzed: heart, gastrocnemius, red quadriceps, and white quadriceps. This variable response between different muscle types may relate to the higher thyroid hormone receptor content of soleus muscle (3). The absence of a decrease in LKB1 protein and activity in immunoprecipitates of the soleus of Hypo rats may be explained by a delay in decline of plasma thyroid hormones after PTU administration was initiated. A small decrease was noted in the soleus homogenate supernatant blots, and a trend was noted in the immunoprecipitates. PTU inhibits iodination of tyrosine residues of thyroglobulin and coupling of iodotyrosines to form thyroxine (5). The thyroid normally stores considerable thyroxine in peptide linkages of thyroglobulin in the follicles, and it was likely several days after initiation of PTU treatment before a significant drop in plasma levels of thyroid hormones occurred. With a more prolonged treatment with PTU, larger decreases in LKB1 would likely be observed.

Plasma adipokines have previously been demonstrated to influence both expression and activity of AMPK (41, 54). Leptin and adiponectin increase and resistin decreases activation. Prolonged leptin infusion into rats increases expression of AMPK subunits, as well as increases phosphorylation/activation (41). With the marked decrease in adipose tissue mass in the Hyper rats, we might expect to see alterations in adipokine production. Previous reports indicate plasma leptin decreases, whereas plasma adiponectin increases with hyperthyroidism (2, 6). This divergence in plasma concentration of these two activators makes it difficult to predict the net effect of excess thyroid hormones on AMPK expression and activity.

The coimmunoprecipitation studies demonstrate association of MO25 with LKB1 in the skeletal muscle homogenates. To our knowledge, this is the first report providing evidence of association of MO25 with LKB1 in skeletal muscle. The same magnitude of increase in both LKB1 and MO25 in response to hyperthyroidism was observed in supernatants of the crude homogenates and in the LKB1 immunoprecipitate of soleus muscle. The same general pattern was seen in LKB1 activity (capacity of LKB1 immunoprecipitates to phosphorylate LKBtide) with respect to thyroid state. We are not aware of data clearly demonstrating that STRAD is the protein associating with LKB1 in skeletal muscle. We had a STRAD antibody commercially prepared using recombinant human STRAD. This antibody detected the recombinant STRAD and a protein band in muscle extracts at the correct molecular mass. We were unable to detect STRAD in LKB1 immunoprecipitates with this antibody. It is unclear whether this was due to nonspecificity of the antibody or to the existence of another STRAD-like protein in muscle required for enhancement of LKB1 activity. Additional studies are required to show which protein binding partners are necessary for full activity of LKB1 in skeletal muscle.

The mechanism by which LKB1 and MO25 expression increased in this study is unknown. Since thyroid hormone generally elicits a cellular response by means of binding to a receptor in the nucleus, it would seem likely that thyroid hormone would increase transcription of the genes that encode for LKB1 and MO25. This assumption proved to be incorrect. MO25 mRNA increased to 170% of Cntrl levels in response to thyroid hormone treatment, following the trend observed by Western blot, but LKB1 and STRAD mRNA did not increase significantly. STRAD [National Center for Biotechnology Information (NCBI) Accession no. AC015651] has a potential thyroid response element (GGATCACCTGAGGTCA) ~1,500 bases upstream from the start sequence, but promoters of LKB1 (STK11, NCBI Accession no. AC011544) (8, 16) and MO25 (NCBI Accession no. AC084031) were replete of thyroid response elements. It is interesting that MO25 mRNA was the only one of the three analyzed that increased, although the protein content of LKB1 and MO25 both increased in the soleus of Hyper rats. We observed similar results in our laboratory in a study on endurance training, when we analyzed the red quadriceps of trained rats (44). LKB1 and MO25 protein content of muscle increased, but only MO25 mRNA expression increased. The increase in MO25 mRNA observed in our current study may, in part, be responsible for the increase in MO25 protein expression, but it is unlikely that an increase in transcription rate is responsible for the increase in LKB1 protein content of the muscle.

The prevailing p-AMPK and p-ACC were consistently higher in resting gastrocnemius and soleus muscles, and {alpha}2-AMPK activity was higher in the soleus of the Hyper rats. The p-AMPK, but not p-ACC, was lower in the Hypo rats than in Cntrl. This chronic activation of AMPK in the Hyper rats with consequent increased phosphorylation of downstream targets could be responsible, in part, for the increase in mitochondrial biogenesis. Electrical stimulation of the left tibial nerve activated AMPK and increased phosphorylation of AMPK and ACC in the gastrocnemius of Cntrl, Hyper, and Hypo rats. After 5-min stimulation, p-ACC, but not p-AMPK, increased to higher levels in the Hyper than in the Hypo or Cntrl rats. Considering p-ACC as an endogenous reporter for AMPK activity, this provides evidence that the AMPK activity in the live working muscle was higher in the Hyper group, likely due to allosteric activation by AMP. In the soleus, electrical stimulation caused an increase in both {alpha}1- and {alpha}2-AMPK activity in immunoprecipitates, but only in the Hyper rats. The p-AMPK was increased in both Hyper and Hypo rats, and the p-ACC was increased in all three treatment groups in response to stimulation. Although no change was noted in AMPK activity or p-AMPK in the Cntrl soleus muscles in response to stimulation, the increase in p-ACC lends support to the idea that AMPK was more active in these muscles in vivo. Allosteric effects would not be detected in either the AMPK activity assay or in the Western blot for p-AMPK. It seems clear that, whether at rest or in more energy-challenging states, AMPK is more active in the Hyper muscle. This could be due to an increase in LKB1 expression and activity and to increased expression of AMPK subunits in the case of the soleus. In fact, the magnitude of the increase in p-AMPK was similar to the magnitude of the increase in total AMPK-{alpha}, implying that the same proportion of total AMPK was phosphorylated in both Cntrl and Hyper soleus. In the case of the gastrocnemius, which exhibited no significant increase in LKB1, the increased expression of AMPK subunits likely played a role.

CREB is a transcription factor involved in numerous cellular and metabolic processes (27). It binds to CRE on promoters of target genes, and it can be activated by phosphorylation at the serine 133 position (21). This phosphorylation allows for recruitment of CREB binding protein or p300, two similar proteins that have histone acetylase activity, as well as the ability to interact with basal transcription factors, such as TFIIB and TATA-binding protein (21, 38). There are CREs on many different genes involved in cell proliferation, differentiation, and division, as well as metabolic regulation, and, when CREB is activated, it can facilitate the transcription of these genes (30, 38, 39, 43). We observed an increase in p-CREB in the soleus, heart, and red quadriceps of Hyper rats. This increase could occur through various different pathways, since CREB can be phosphorylated by a number of different kinases (21). The best known pathway is through PKA, but it is dependent on cAMP concentration. In cultured avian myoblasts, triiodothyronine has been reported to increase cAMP and phosphorylation of CREB (25). In mature rat soleus muscle, however, cAMP levels have been shown to decrease in response to the same thyroid hormone dose used in the present study (48). It is unlikely, therefore, that the increase in CREB phosphorylation was due to PKA activation, and we must consider other kinases. Since AMPK is more active in the Hyper muscle, and CREB is a demonstrated direct target of AMPK (46), it is reasonable to suggest that AMPK mediates this increase in p-CREB. In cardiac myocytes, phosphorylation of CREB has been associated with phenylephrine-induced hypertrophy (26). Hypertrophy of cardiac myocytes does not occur in the absence of p300 and CREB binding protein signaling, along with accompanying histone acetylase activity (9, 10). However, chronic activation of AMPK in cardiac myocytes after transfection with LKB1, STRAD-{alpha}, and MO25-{alpha} actually decreases phenylephrine-induced protein synthesis (31).

The increase in PGC-1{alpha} in soleus muscle of Hyper rats confirmed previous observations by Irrcher et al. (18). It is also known that CREB induces expression of PGC-1{alpha}, at least in the liver (17). Since we observed that thyroid hormone treatment increased AMPK activity, as well as CREB phosphorylation, the increase in PGC-1{alpha} is likely a consequence. It was interesting to note, however, that, although p-AMPK and p-CREB increased in various tissue types (albeit to a smaller extent) upon treatment with thyroid hormone, PGC-1{alpha} only increased in the soleus. This observation is consistent with the previous observation that soleus muscle (composed of type I fibers) is more responsive than other muscle types (type II) to thyroid hormone induction of mitochondrial biogenesis (48, 52).

The increase in LKB1 and AMPK signaling induced by thyroid hormone could be partially responsible for some of thyroid hormone's effects on metabolism. Hyperthyroidism results in marked increases in glucose uptake, fatty acid oxidation, and oxidative capacity (34, 42, 48). The induction of PGC-1{alpha} has been shown in muscle cells in culture to induce synthesis of mitochondrial enzymes involved in oxidation of pyruvate and fatty acids (11, 23, 29). AMPK has been shown to relieve the malonyl-CoA inhibition of carnitine palmitoyltransferase-1 by inactivating ACC (51). It, therefore, seems possible that the increase in fatty acid oxidation observed in hyperthyroid patients occurs by increasing expression of LKB1, MO25, and AMPK subunits, leading to subsequent AMPK activation and consequent increased PGC-1{alpha} expression. It has been shown that thyrotoxicosis induces increased expression of mitochondrial proteins, such as citrate synthase, cytochrome oxidase, {alpha}-glycerophosphate dehydrogenase, and 3-hydroxybutyrate dehydrogenase, in skeletal muscle, especially the soleus (48, 52). Malate dehydrogenase, succinate dehydrogenase, citrate synthase activity, and hexokinase II all increase in soleus of rats treated with 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside injections (53). Conversely, LKB1 knockout mice exhibit decreases in citrate synthase activity (47). It is, therefore, conceivable that thyroid hormone-induced increases in LKB1 complex proteins, and the ensuing activation of AMPK, mediate, in part, the thyroid hormone-induced increase in oxidative capacity.

Although most of the actions of thyroid hormones are mediated by changes in gene transcription, evidence has recently been provided indicating triiodothyronine can activate AMPK acutely in soleus, plantaris, and heart within 2 h of injection (19). Authors point out, however, that plasma levels of triiodothyronine used to elicit this response were considerably higher than the physiological range. The mechanism of this rapid activation and the dose response for these acute effects are yet to be determined.

In conclusion, we found that thyroid hormone treatment does increase LKB1 and MO25 protein content of soleus muscle, as well as the phosphorylation of AMPK upon electrical stimulation. LKB1 and MO25 are binding partners in skeletal muscle and increase concurrently in soleus muscle in response to thyroid hormone. Thyroid hormone treatment also increases the phosphorylation of CREB in the soleus and increases muscle content of four proteins that have CREs. These results suggest that thyroid hormones play a role in the regulation of the LKB1/AMPK signaling proteins and on the activation of CREB in skeletal muscle.


    FOOTNOTES
 

Address for reprint requests and other correspondence: W. W. Winder, Dept. of Physiology and Developmental Biology, Brigham Young Univ., Provo, UT 84602 (e-mail: william_winder{at}byu.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alessi DR, Sakamoto K, Bayascas JR. LKB1-dependent signaling pathways. Annu Rev Biochem 75: 137–163, 2006.[CrossRef][Web of Science][Medline]
  2. Aragao CN, Souza LL, Cabanelas A, Oliveira KJ, Pazos-Moura CC. Effect of experimental hypo- and hyperthyroidism on serum adiponectin. Metabolism 56: 6–11, 2007.[CrossRef][Web of Science][Medline]
  3. Bahi L, Garnier A, Fortin D, Serrurier B, Veksler V, Bigard AX, Ventura-Clapier R. Differential effects of thyroid hormones on energy metabolism of rat slow- and fast-twitch muscles. J Cell Physiol 203: 589–598, 2005.[CrossRef][Web of Science][Medline]
  4. Boudeau J, Baas AF, Deak M, Morrice NA, Kieloch A, Schutkowski M, Prescott AR, Clevers HC, Alessi DR. MO25alpha/beta interact with STRADalpha/beta enhancing their ability to bind, activate and localize LKB1 in the cytoplasm. EMBO J 22: 5102–5114, 2003.[CrossRef][Web of Science][Medline]
  5. Cooper DS. Antithyroid drugs for the treatment of hyperthyroidism caused by Graves' disease. Endocrinol Metab Clin North Am 27: 225–247, 1998.[CrossRef][Web of Science][Medline]
  6. Escobar-Morreale HF, Escobar del Rey F, Morreale de Escobar G. Thyroid hormones influence serum leptin concentrations in the rat. Endocrinology 138: 4485–4488, 1997.[Abstract/Free Full Text]
  7. Gonzalez GA, Montminy MR. Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59: 675–680, 1989.[CrossRef][Web of Science][Medline]
  8. Grimwood J, Gordon LA, Olsen A, Terry A, Schmutz J, Lamerdin J, Hellsten U, Goodstein D, Couronne O, Tran-Gyamfi M, Aerts A, Altherr M, Ashworth L, Bajorek E, Black S, Branscomb E, Caenepeel S, Carrano A, Caoile C, Chan YM, Christensen M, Cleland CA, Copeland A, Dalin E, Dehal P, Denys M, Detter JC, Escobar J, Flowers D, Fotopulos D, Garcia C, Georgescu AM, Glavina T, Gomez M, Gonzales E, Groza M, Hammon N, Hawkins T, Haydu L, Ho I, Huang W, Israni S, Jett J, Kadner K, Kimball H, Kobayashi A, Larionov V, Leem SH, Lopez F, Lou Y, Lowry S, Malfatti S, Martinez D, McCready P, Medina C, Morgan J, Nelson K, Nolan M, Ovcharenko I, Pitluck S, Pollard M, Popkie AP, Predki P, Quan G, Ramirez L, Rash S, Retterer J, Rodriguez A, Rogers S, Salamov A, Salazar A, She X, Smith D, Slezak T, Solovyev V, Thayer N, Tice H, Tsai M, Ustaszewska A, Vo N, Wagner M, Wheeler J, Wu K, Xie G, Yang J, Dubchak I, Furey TS, DeJong P, Dickson M, Gordon D, Eichler EE, Pennacchio LA, Richardson P, Stubbs L, Rokhsar DS, Myers RM, Rubin EM, Lucas SM. The DNA sequence and biology of human chromosome 19. Nature 428: 529–535, 2004.[CrossRef][Web of Science][Medline]
  9. Gusterson R, Brar B, Faulkes D, Giordano A, Chrivia J, Latchman D. The transcriptional co-activators CBP and p300 are activated via phenylephrine through the p42/p44 MAPK cascade. J Biol Chem 277: 2517–2524, 2002.[Abstract/Free Full Text]
  10. Gusterson RJ, Jazrawi E, Adcock IM, Latchman DS. The transcriptional co-activators CREB-binding protein (CBP) and p300 play a critical role in cardiac hypertrophy that is dependent on their histone acetyltransferase activity. J Biol Chem 278: 6838–6847, 2003.[Abstract/Free Full Text]
  11. Handschin C, Chin S, Li P, Liu F, Maratos-Flier E, Lebrasseur NK, Yan Z, Spiegelman BM. Skeletal muscle fiber-type switching, exercise intolerance, and myopathy in PGC-1alpha muscle-specific knock-out animals. J Biol Chem 282: 30014–30021, 2007.[Abstract/Free Full Text]
  12. Hanson RW, Reshef L. Regulation of phosphoenolpyruvate carboxykinase (GTP) gene expression. Annu Rev Biochem 66: 581–611, 1997.[CrossRef][Web of Science][Medline]
  13. Hardie DG. AMP-activated protein kinase as a drug target. Annu Rev Pharmacol Toxicol 47: 185–210, 2007.[CrossRef][Web of Science][Medline]
  14. Hardie DG. Role of AMP-activated protein kinase in the metabolic syndrome and in heart disease. FEBS Lett 582: 81–89, 2008.[CrossRef][Web of Science][Medline]
  15. Hawley SA, Boudeau J, Reid JL, Mustard KJ, Udd L, Makela TP, Alessi DR, Hardie DG. Complexes between the LKB1 tumor suppressor, STRAD alpha/beta and MO25 alpha/beta are upstream kinases in the AMP-activated protein kinase cascade. J Biol 2: 28, 2003.[CrossRef][Medline]
  16. Hearle NC, Tomlinson I, Lim W, Murday V, Swarbrick E, Lim G, Phillips R, Lee P, O'Donohue J, Trembath RC, Morrison PJ, Norman A, Taylor R, Hodgson S, Lucassen A, Houlston RS. Sequence changes in predicted promoter elements of STK11/LKB1 are unlikely to contribute to Peutz-Jeghers syndrome. BMC Genomics 6: 38, 2005.[CrossRef][Medline]
  17. Herzig S, Long F, Jhala US, Hedrick S, Quinn R, Bauer A, Rudolph D, Schutz G, Yoon C, Puigserver P, Spiegelman B, Montminy M. CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 413: 179–183, 2001.[CrossRef][Web of Science][Medline]
  18. Irrcher I, Adhihetty PJ, Sheehan T, Joseph AM, Hood DA. PPAR-{gamma} coactivator-1{alpha} expression during thyroid hormone- and contractile activity-induced mitochondrial adaptations. Am J Physiol Cell Physiol 284: C1669–C1677, 2003.[Abstract/Free Full Text]
  19. Irrcher I, Walkinshaw DR, Sheehan TE, Hood DA. Thyroid hormone (T3) rapidly activates p38 and AMPK in skeletal muscle in vivo. J Appl Physiol 104: 178–185, 2008.[Abstract/Free Full Text]
  20. Jensen TE, Rose AJ, Jorgensen SB, Brandt N, Schjerling P, Wojtaszewski JF, Richter EA. Possible CaMKK-dependent regulation of AMPK phosphorylation and glucose uptake at the onset of mild tetanic skeletal muscle contraction. Am J Physiol Endocrinol Metab 292: E1308–E1317, 2007.[Abstract/Free Full Text]
  21. Johannessen M, Delghandi MP, Moens U. What turns CREB on? Cell Signal 16: 1211–1227, 2004.[CrossRef][Web of Science][Medline]
  22. Koh HJ, Arnolds DE, Fujii N, Tran TT, Rogers MJ, Jessen N, Li Y, Liew CW, Ho RC, Hirshman MF, Kulkarni RN, Kahn CR, Goodyear LJ. Skeletal muscle-selective knockout of LKB1 increases insulin sensitivity, improves glucose homeostasis, and decreases TRB3. Mol Cell Biol 26: 8217–8227, 2006.[Abstract/Free Full Text]
  23. Koves TR, Li P, An J, Akimoto T, Slentz D, Ilkayeva O, Dohm GL, Yan Z, Newgard CB, Muoio DM. Peroxisome proliferator-activated receptor-gamma co-activator 1alpha-mediated metabolic remodeling of skeletal myocytes mimics exercise training and reverses lipid-induced mitochondrial inefficiency. J Biol Chem 280: 33588–33598, 2005.[Abstract/Free Full Text]
  24. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2[-delta delta C(T)] method. Methods 25: 402–408, 2001.[CrossRef][Web of Science][Medline]
  25. Marchal S, Cassar-Malek I, Magaud JP, Rouault JP, Wrutniak C, Cabello G. Stimulation of avian myoblast differentiation by triiodothyronine: possible involvement of the cAMP pathway. Exp Cell Res 220: 1–10, 1995.[CrossRef][Web of Science][Medline]
  26. Markou T, Hadzopoulou-Cladaras M, Lazou A. Phenylephrine induces activation of CREB in adult rat cardiac myocytes through MSK1 and PKA signaling pathways. J Mol Cell Cardiol 37: 1001–1011, 2004.[CrossRef][Web of Science][Medline]
  27. Mayr B, Montminy M. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat Rev Mol Cell Biol 2: 599–609, 2001.[CrossRef][Web of Science][Medline]
  28. McGee SL, Mustard KJ, Hardie DG, Baar K. Normal hypertrophy accompanied by phosphoryation and activation of AMP-activated protein kinase alpha1 following overload in LKB1 knockout mice. J Physiol 586: 1731–1741, 2008.[Abstract/Free Full Text]
  29. Muoio DM, Koves TR. Skeletal muscle adaptation to fatty acid depends on coordinated actions of the PPARs and PGC1 alpha: implications for metabolic disease. Appl Physiol Nutr Metab 32: 874–883, 2007.[Web of Science][Medline]
  30. Nair A, Vaidya VA. Cyclic AMP response element binding protein and brain-derived neurotrophic factor: molecules that modulate our mood? J Biosci 31: 423–434, 2006.[CrossRef][Web of Science][Medline]
  31. Noga AA, Soltys CL, Barr AJ, Kovacic S, Lopaschuk GD, Dyck JR. Expression of an active LKB1 complex in cardiac myocytes results in decreased protein synthesis associated with phenylephrine-induced hypertrophy. Am J Physiol Heart Circ Physiol 292: H1460–H1469, 2007.[Abstract/Free Full Text]
  32. Park SH, Gammon SR, Knippers JD, Paulsen SR, Rubink DS, Winder WW. Phosphorylation-activity relationships of AMPK and acetyl-CoA carboxylase in muscle. J Appl Physiol 92: 2475–2482, 2002.[Abstract/Free Full Text]
  33. Park SH, Paulsen SR, Gammon SR, Mustard KJ, Hardie DG, Winder WW. Effects of thyroid state on AMP-activated protein kinase and acetyl-CoA carboxylase expression in muscle. J Appl Physiol 93: 2081–2088, 2002.[Abstract/Free Full Text]
  34. Randin JP, Scazziga B, Jequier E, Felber JP. Study of glucose and lipid metabolism by continuous indirect calorimetry in Graves' disease: effect of an oral glucose load. J Clin Endocrinol Metab 61: 1165–1171, 1985.[Abstract/Free Full Text]
  35. Sadana P, Park EA. Characterization of the transactivation domain in the peroxisome-proliferator-activated receptor gamma co-activator (PGC-1). Biochem J 403: 511–518, 2007.[CrossRef][Web of Science][Medline]
  36. Sakamoto K, McCarthy A, Smith D, Green KA, Grahame Hardie D, Ashworth A, Alessi DR. Deficiency of LKB1 in skeletal muscle prevents AMPK activation and glucose uptake during contraction. EMBO J 24: 1810–1820, 2005.[CrossRef][Web of Science][Medline]
  37. Schimmack G, Defronzo RA, Musi N. AMP-activated protein kinase: role in metabolism and therapeutic implications. Diabetes Obes Metab 8: 591–602, 2006.[CrossRef][Web of Science][Medline]
  38. Servillo G, Della Fazia MA, Sassone-Corsi P. Coupling cAMP signaling to transcription in the liver: pivotal role of CREB and CREM. Exp Cell Res 275: 143–154, 2002.[CrossRef][Web of Science][Medline]
  39. Shaywitz AJ, Greenberg ME. CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu Rev Biochem 68: 821–861, 1999.[CrossRef][Web of Science][Medline]
  40. Stein SC, Woods A, Jones NA, Davison MD, Carling D. The regulation of AMP-activated protein kinase by phosphorylation. Biochem J 345: 437–443, 2000.[CrossRef][Web of Science][Medline]
  41. Steinberg GR, Rush JW, Dyck DJ. AMPK expression and phosphorylation are increased in rodent muscle after chronic leptin treatment. Am J Physiol Endocrinol Metab 284: E648–E654, 2003.[Abstract/Free Full Text]
  42. Sugden MC, Liu YL, Holness MJ. Glucose utilization by skeletal muscles in vivo in experimental hyperthyroidism in the rat. Biochem J 271: 421–425, 1990.[Web of Science][Medline]
  43. Tardito D, Perez J, Tiraboschi E, Musazzi L, Racagni G, Popoli M. Signaling pathways regulating gene expression, neuroplasticity, and neurotrophic mechanisms in the action of antidepressants: a critical overview. Pharmacol Rev 58: 115–134, 2006.[Abstract/Free Full Text]
  44. Taylor EB, Hurst D, Greenwood LJ, Lamb JD, Cline TD, Sudweeks SN, Winder WW. Endurance training increases LKB1 and MO25 protein but not AMP-activated protein kinase kinase activity in skeletal muscle. Am J Physiol Endocrinol Metab 287: E1082–E1089, 2004.[Abstract/Free Full Text]
  45. Thomson DM, Brown JD, Fillmore N, Condon BM, Kim HJ, Barrow JR, Winder WW. LKB1 and the regulation of malonyl-CoA and fatty acid oxidation in muscle. Am J Physiol Endocrinol Metab 293: E1572–E1579, 2007.[Abstract/Free Full Text]
  46. Thomson DM, Herway ST, Fillmore N, Kim H, Brown JD, Barrow JR, Winder WW. AMP-activated protein kinase phosphorylates transcription factors of the CREB family. J Appl Physiol 104: 429–438, 2008.[Abstract/Free Full Text]
  47. Thomson DM, Porter BB, Tall JH, Kim HJ, Barrow JR, Winder WW. Skeletal muscle and heart LKB1 deficiency causes decreased voluntary running and reduced muscle mitochondrial marker enzyme expression in mice. Am J Physiol Endocrinol Metab 292: E196–E202, 2007.[Abstract/Free Full Text]
  48. Winder WW. Time course of the T3- and T4-induced increase in rat soleus muscle mitochondria. Am J Physiol Cell Physiol 236: C132–C138, 1979.[Abstract/Free Full Text]
  49. Winder WW, Baldwin KM, Terjung RL, Holloszy JO. Effects of thyroid hormone administration on skeletal muscle mitochondria. Am J Physiol 228: 1341–1345, 1975.[Abstract/Free Full Text]
  50. Winder WW, Hardie DG. AMP-activated protein kinase, a metabolic master switch: possible roles in type 2 diabetes. Am J Physiol Endocrinol Metab 277: E1–E10, 1999.[Abstract/Free Full Text]
  51. Winder WW, Hardie DG. Inactivation of acetyl-CoA carboxylase and activation of AMP-activated protein kinase in muscle during exercise. Am J Physiol Endocrinol Metab 270: E299–E304, 1996.[Abstract/Free Full Text]
  52. Winder WW, Holloszy JO. Response of mitochondria of different types of skeletal muscle to thyrotoxicosis. Am J Physiol Cell Physiol 232: C180–C184, 1977.[Abstract/Free Full Text]
  53. Winder WW, Holmes BF, Rubink DS, Jensen EB, Chen M, Holloszy JO. Activation of AMP-activated protein kinase increases mitochondrial enzymes in skeletal muscle. J Appl Physiol 88: 2219–2226, 2000.[Abstract/Free Full Text]
  54. Xue B, Kahn BB. AMPK integrates nutrient and hormonal signals to regulate food intake and energy balance through effects in the hypothalamus and peripheral tissues. J Physiol 574: 73–83, 2006.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
DiabetesHome page
M. Kelly, M.-S. Gauthier, A. K. Saha, and N. B. Ruderman
Activation of AMP-Activated Protein Kinase by Interleukin-6 in Rat Skeletal Muscle: Association With Changes in cAMP, Energy State, and Endogenous Fuel Mobilization
Diabetes, September 1, 2009; 58(9): 1953 - 1960.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
L. N. Sutherland, M. R. Bomhof, L. C. Capozzi, S. A.U. Basaraba, and D. C. Wright
Exercise and adrenaline increase PGC-1{alpha} mRNA expression in rat adipose tissue
J. Physiol., April 1, 2009; 587(7): 1607 - 1617.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
105/4/1218    most recent
00997.2007v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Branvold, D. J.
Right arrow Articles by Winder, W. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Branvold, D. J.
Right arrow Articles by Winder, W. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.