J Appl Physiol 104: 1753-1760, 2008.
First published March 27, 2008; doi:10.1152/japplphysiol.00875.2007
8750-7587/08 $8.00
STAT-3 regulates surfactant phospholipid homeostasis in normal lung and during endotoxin-mediated lung injury
Machiko Ikegami,
Angelica Falcone, and
Jeffrey A. Whitsett
Division of Pulmonary Biology, Cincinnati Children's Hospital, University of Cincinnati, Cincinnati, Ohio
Submitted 15 August 2007
; accepted in final form 24 March 2008
 |
ABSTRACT
|
|---|
Acute lung injury associated with surfactant deficiency remains a major cause of pulmonary morbidity and mortality. Since signal transducer and activator of transcription-3 (STAT-3) plays an important role in protecting respiratory epithelial cells during injury, we hypothesized that STAT-3 may regulate gene expression in type II cells that mediate surfactant phospholipid synthesis. Conditional deletion of Stat-3 in respiratory epithelial cells in the lung of transgenic mice (Stat-3
/
mice) decreased surfactant phospholipid synthesis and secretion. Deletion of Stat-3 was associated with decreased expression of Akt2, Srebf-1, and other genes expressed in type II cells that may influence surfactant phospholipid synthesis (Glut-1, Slc34a2, Gpam, Acox2, and Cds2). Stat-3
/
mice were more susceptible to intratracheal lipopolysaccharide (LPS). Saturated phosphatidylcholine and surfactant protein B levels were significantly decreased in bronchoalveolar lavage fluid from LPS-treated Stat-3
/
mice. Alveolar capillary leak, proinflammatory cytokine expression, and perturbations of lung mechanics caused by LPS were exacerbated after deletion of STAT-3. STAT-3 plays a critical role in the regulation of surfactant lipid synthesis in the normal lung and during lung injury caused by LPS.
acute lung injury; lipopolysaccharide; cytokine signaling; Akt2; Srebf-1
PULMONARY SURFACTANT IS A complex mixture of lipids and proteins that are synthesized and secreted by alveolar type II epithelial cells. Surfactant adsorbs to the air-liquid interface and forms saturated phosphatidylcholine (Sat PC)-rich surfactant films that reduce surface tension in a process that is dependent on surfactant protein (SP)-B (49). While surfactant pool sizes are tightly regulated in the normal lung, the transcriptional mechanisms regulating genes critical for surfactant phospholipid homeostasis are not well understood.
Acute lung injury (ALI) remains a common cause of morbidity and mortality following pulmonary or systemic infection (6). Lipopolysaccharide (LPS) is a constituent of the outer cell wall of gram-negative microorganisms. During bacterial infection, LPS increases capillary permeability, expression of cellular adhesion molecules, proinflammatory cytokines, and chemokines, which associate with ALI (42, 47). Surfactant homeostasis is disrupted in ALI, caused by factors that include a lack of surface-active components, changes in the surfactant composition, and inhibition of surfactant function by serum proteins that leak into the injured alveoli (11, 34). The transcriptional mechanisms that maintain or increase surfactant phospholipids during the acute phase of lung injury and lead to a recovery are poorly understood.
Signal transducer and activator of transcription-3 (STAT-3) is a member of the STAT family of transcription factors that regulates the expression of many acute-phase response genes. STAT-3 is activated by members of the IL-6-like group of proinflammatory cytokines (1, 54). STAT-3 is activated by tyrosine phosphorylation mediated by janus kinases and dimerization, via p-Tyr-SH2 domain interactions that cause nuclear translocation and transcriptional activation of responsive genes (30). Since deletion of the Stat-3 gene before gastrulation is lethal (44), the function of STAT-3 in various organs has been examined in cell culture systems and after conditional deletion in transgenic mice models in which STAT-3 is deleted in specific cells (3, 4, 7, 37, 43). STAT-3 is expressed in various cell types in the lung, including alveolar epithelial type II cells. We previously developed transgenic mice in which Cre was conditionally expressed to delete the Stat-3 gene in respiratory epithelial cells of the lung (Stat-3
/
mice) (15). While postnatal lung function was maintained, Stat-3
/
mice were highly susceptible to hyperoxia (15) and intratracheal (IT) administration of adenovirus (27). Increased mortality of Stat-3
/
mice was observed following hyperoxia and was associated with decreased SP-B (15). IT adenovirus caused severe lung injury in Stat-3
/
mice that was associated with increased apoptosis. In the present study, lung injury was induced in Stat-3
/
mice by IT injection of LPS. Previous studies by RNA microarray analysis of type II cells isolated from Stat-3
/
mice demonstrated significant changes in expression of numerous genes associating with cytoprotection of the lung, including those genes regulating lipid synthesis (27, 52). In the present study, expression of a number of genes related to synthesis of surfactant phospholipids was influenced by deletion of the Stat-3 gene in the normal and injured lung. STAT-3 plays an important role in LPS-induced lung injury, serving to maintain pulmonary homeostasis and repair.
 |
MATERIALS AND METHODS
|
|---|
Transgenic mice with conditional deletion of STAT-3 in respiratory epithelial cells.
Triple transgenic mice [SP-C-rtTA–/tg/(tetO)7CMV-Cretg/tg/Stat-3flx/flx], herein termed Stat-3
/
, were generated as previously reported (15). Stat-3flx/flx mice were kindly provided by Dr. Takeda (Hyogo College of Medicine, Hyogo, Japan) (44). Stat-3flx/flx littermates lacking either rtTA or Cre genes served as controls. These two control line mice were similar, and their lung structure remained normal until they were over 1 yr old. Mice were housed in a pathogen-free, humidity- and temperature-controlled vivarium on a 12:12-h light-dark cycle, in accordance with institutional guidelines. There was no serological evidence of pulmonary pathogens or bacterial infections in sentinel mice maintained within the colony. Dams bearing control and Stat-3
/
mice were maintained on doxycycline in food (625 mg/kg: Harlan Teklad, Madison, WI) from embryonic day 0 until postnatal day 14, resulting in extensive deletion of Stat-3 in respiratory epithelial cells. Mice were then provided normal food. All mice were studied at ages 7–8 wk under protocols approved by the Institutional Animal Care and Use Committee at Cincinnati Children's Hospital Research Foundation.
Surfactant Sat PC synthesis and secretion.
By intraperitoneal injection, Stat-3
/
and control mice were given 10 µl/g body wt, containing 1 µCi [3H]palmitic acid that was stabilized in 0.9% NaCl with 5% human serum albumin (19). Groups of six mice were killed at 8 h after radiolabeled precursor for surfactant phospholipid injection. Bronchoalveolar lavage (BAL) fluid (BALF) was recovered from each animal, and then lung tissue was homogenized in saline. Sat PC was isolated from the BALF and lung homogenate as described below. Radioactivity and amount of phosphorus (14) in isolated Sat PC from BALF, lung homogenate after BAL, and total lung (BALF + lung homogenate) were measured to study the incorporation of radiolabeled surfactant precursor into surfactant Sat PC. The percent secretion of radiolabeled Sat PC was calculated as the percentage of radioactivity in BALF Sat PC relative to the radioactivity in total lung Sat PC.
[3H]PC secretion from cultured type II cells was assessed as described previously (36). Similar numbers of type II cells were isolated from control and Stat-3
/
mice. Cells were maintained in culture for 5 days and then labeled with 1 µCi/ml [3H]choline for 48 h. Cells were washed to remove free label. After 3 h, media were removed, and cells were rinsed with fresh media and collected after centrifugation (284 g x 10 min). Cells were removed from the plates with methanol. Radioactivity in the extracted lipids from the media and cell samples was counted, and percent phospholipid secretion was calculated as (radioactivity in media) ÷ (radioactivity of media + cells) x 100.
Validation of mRNAs.
RT-PCR was used to validate changes in several mRNAs related to phospholipid synthesis that were previously detected in Stat-3
/
mice by mRNA microarray analysis (27, 52). Changes in mRNA were determined in type II cells isolated from Stat-3
/
and controls (n = 5/group). RNA was extracted from isolated type II cells using the RNeasy Mini Kit (Qiagen, Valencia, CA). cDNA was synthesized by using 5 µg total RNA and high-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Quantitative RT-PCR was analyzed using TaqMan gene expression assays (Applied Biosystems). All probes, including the probe for β-actin as the endogenous control, were selected from the list of Applied Biosystems, with the exception of Srebf-1. Twenty-five nanograms of input cDNA were used for each sample. Cycle thresholds for β-actin were similar in Stat-3
/
(19.0 ± 0.4) and control (19.3 ± 0.5) mice (P > 0.05, n = 5/group). The probe for Srebf-1 was designed to bind at the exon-exon junction that is unique to Srebp-1c using the sequence ATCGGCGCGGAAGCTGTCGGGGTAGCGTCTGCACGCCCTAGGGGATCGGCGCGGACCACGGAGCCATGGATTGCACATTTGAAGACATGCTCCAGCTCATCAACAACCAAGACAGTGACTTCCCGGGCCTGTTTGACGCCC (40).
Lung injury induced by IT LPS.
Mice were anesthetized by 25% isoflurane and intubated orally with a 24-gauge feeding needle, and 10 µg of LPS suspended in 80 µl of 0.9% NaCl were administered IT (18). Mice treated identically with 0.9% NaCl served as experimental control. Mice recovered from anesthesia immediately after IT instillation.
Quantification of STAT-3 mRNA in lung tissue and isolated type II cells.
Type II cells were isolated from control and Stat-3
/
mice using collagenase and differential plating (36). Lung tissue and type II cells were homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA), and the RNA was extracted. After DNase treatment, cDNA was synthesized by using Superscript II. Quantitative RT-PCR for STAT-3 and β-actin mRNAs was performed using Smart Cycler (Cepheid, Sunnyvale, CA), as described before (15).
BALF and lung homogenate samples.
At a preassigned time after LPS IT, mice were deeply anesthetized with intraperitoneal pentobarbital sodium (100 mg/kg) and killed by exsanguination. Untreated mice were evaluated as the 0-h group. IT injection of 0.9% NaCl (experimental control) did not influence surfactant contents, lung inflammation, lung morphology, and lung mechanics 0.75 to 16 h after injection, and all were similar to that of 0-h group. Therefore, we have presented 0-h group as the baseline. BALF samples were obtained by pooling five 1-ml aliquots of 0.9% NaCl, which were instilled into the lungs and withdrawn three times to obtain each aliquot. BALF volumes were similar to all groups of mice (control: 4.47 ± 0.03, Stat-3
/
: 4.43 ± 0.05 ml, n = 20/group). Aliquots of BALF were used to determine Sat PC, inflammatory cell numbers, differential cell counts, SPs, and total protein. After BAL, lungs were homogenized for Sat PC analyses. IL-1β, IL-6, and macrophage inflammatory protein-2 (MIP-2) levels were determined in supernatants of lung homogenates after centrifuge at 1,500 g for 15 min using quantitative murine sandwich ELISA kits (R&D Systems, Minneapolis, MN).
Sat PC, total phospholipid, surfactant proteins, and total protein.
Sat PC was isolated from lipid extracts of BALF and lung homogenates. Lipids were reacted with osmium tetroxide (25), followed by phosphorus measurement (14). Percent Sat PC in BALF relative to total lung Sat PC was calculated. For total phospholipid quantification, phosphorus was measured on the lipid extracts of BALF. The volumes of recovered BALF from all of the groups were similar. Content of SP-A, SP-B, SP-C, and SP-D was determined by Western blot analysis (24) using the same volume BALF for each SP. Immunoreactive bands were detected with enhanced chemiluminescence reagents (Amersham, Chicago, IL), and band intensities were quantified by densitometry (ImageQuant version 5.2, GE Healthcare, Piscataway, NJ). Total protein in aliquots of BALF was measured by the method of Lowry et al. (23) and calculated as milligrams per kilogram body weight.
Lung histology.
Lungs (3 mice/group) were inflation fixed with 4% paraformaldehyde in PBS at 25 cmH2O and immersed in the same fixative. Tissue was fixed overnight, washed with PBS, and dehydrated in a series of alcohols, and six lung lobes were separated and embedded in paraffin. Tissues were stained with hematoxylin and eosin for histology. Six areas of lung tissue in a x40 field of view (0.024 mm2) were randomly selected for each six lung lobes from each animal. Lung inflammation was evaluated as 0 (no inflammation) to 3 (severe inflammation with increased inflammatory cells in the airways) (29) in increments of 0.5.
Lung mechanics.
Four hours after LPS or saline IT, lung mechanics were studied in tracheostomized mice under anesthesia by intraperitoneal injection of ketamine (20 mg/ml) and xylazine (2 mg/ml) in proportion to body weight (0.1 ml/10 g). Mice were ventilated with a tidal volume of 8 ml/kg at a rate of 450 breaths/min (8) and a positive end-expiratory pressure of 2 cmH2O by a computerized FlexiVent System (SCIREQ Scientific Respiratory Equipment, Montreal, Quebec, Canada). This apparatus allows for accurate measurement of volume by using the position of the ventilator piston and pressure in the cylinder. After mechanical ventilation for 2 min, two isolated measurements were performed. For the initial measurement, a sinusoidal 1-Hz oscillation was applied to the tracheal tube. The single-compartment model was fit to these data using a multiple linear regression to calculate dynamic resistance, elastance, and compliance of the airways. For the second measurement, a 16-s forced oscillatory signal containing frequencies between 0.25 and 19.625 Hz was applied to the tracheal tube. Mechanical input impedance of the respiratory system was calculated, and a model containing a constant-phase tissue compartment was fit to input impedance to evaluate tissue damping, tissue elastance, and tissue hysteresivity (12, 15).
Statistical analysis.
Results were presented as means ± SE. Two group comparisons were carried out using unpaired Student's t-test. Comparisons among groups were assessed by ANOVA with Tukey's tests used for post hoc analyses. Scoring of lung histology data is presented as the median score followed by a Mann-Whitney rank-sum test. Differences were considered significant at the 5% level.
 |
RESULTS
|
|---|
Decreased surfactant Sat PC synthesis and secretion in Stat-3
/
mice.
As shown in our laboratory's previous study (15), adult Stat-3
/
mice had a reduced level of Sat PC in BALF and total lung (BALF + lung tissue) (P < 0.05) at baseline. Sat PC in lung tissue after BALF was similar to that of control mice (Fig. 1A), indicating that the reduction in Sat PC was primarily related to decreased alveolar content. In Stat-3
/
mice, percentage of Sat PC in BALF relative to the total lung was significantly reduced to 53% of that in control mice (Fig. 1B).
Body weights were similar in control and Stat-3
/
mice (control: 23.2 ± 0.8, Stat-3
/
: 22.5 ± 0.7 g, n = 24/group). Mice were given body weight-adjusted doses of [3H]palmitic acid by intraperitoneal injection, and the amount of labeled Sat PC was measured in BALF and lung tissue after BAL 8 h after injection. Previous studies demonstrated that uptake of 3H-labeled Sat PC by macrophages and type II cells was minimum 8 h after [3H]palmitic acid injection. This time point was considered optimal to measure the net incorporation of precursors into Sat PC and secretion of labeled Sat PC into the alveoli (19). Incorporation of radiolabeled precursor ([3H]palmitic acid) into Sat PC in BALF, lung tissue, and total lung (Fig. 1C) and percent secretion calculated from [3H]Sat PC in BALF relative to the radioactivity in total lung Sat PC (Fig. 1D) were significantly decreased in Stat-3
/
mice. PC secretion during 3 h was determined in vitro using cultured type II cells isolated from control and Stat-3
/
mice (n = 11 plate/group). Percent secretion of [3H]choline-labeled PC from type II cells was 30% lower in Stat-3
/
mice (6.1 ± 0.4%) than the controls (8.5 ± 0.8%, P < 0.01). Both synthesis and secretion of Sat PC were decreased by deletion of Stat-3 in respiratory epithelial cells.
Deletion of Stat-3 decreased expression of genes regulating surfactant phospholipid synthesis.
RNA microarray analysis of type II cells isolated from Stat-3
/
mice demonstrated decreased expression of a number of genes related to surfactant phospholipid synthesis (27). Akt2, Srebf-1, Acox2, Glut1, Cds2, Slc34a2, and Gpam in RNAs were significantly decreased in type II cells from Stat-3
/
mice (Fig. 2), demonstrating the important role of STAT-3 in regulation of key genes mediating surfactant phospholipid synthesis.
Changes in STAT-3 mRNA after LPS.
In control mice, expression of STAT-3 mRNA was increased in both lung tissue (Fig. 3A) and type II cells (Fig. 3B) after IT LPS injection and returned to the baseline 16 h later. As shown in our previous study, STAT-3 was permanently deleted in Stat-3
/
mice from intrapulmonary respiratory epithelial cells after administration of doxycycline to the dam (15). In lungs of Stat-3
/
mice, STAT-3 mRNA was 50% of that in controls and was increased after LPS injection (Fig. 3A). In contrast, STAT-3 mRNA in isolated type II cells from Stat-3
/
mice was only 10% of that in control mice (Fig. 3B). The purity of isolated type II cells from mice was typically >90%, as assessed by modified Papanicolaou stain, and immunostaining for pro-SP-C (36). The majority of contaminating cells were alveolar macrophages in which STAT-3 was detected. In this system, relatively complete STAT-3 gene deletion occurred in type II cells, whereas expression of Stat-3 in other cells was not altered.
Surfactant homeostasis in Stat-3
/
mice after IT LPS.
Sat PC and phospholipid in BALF was increased in control mice after IT LPS, consistent with acute response to lung injury (Fig. 4, A and C). In contrast Sat PC in Stat-3
/
mice BALF did not increase until 16 h after LPS injection and was significantly lower than in control mice. The decrease in Sat PC was primarily in the alveolar pool. Sat PC in lung homogenates from control and Stat-3
/
mice was similar (Fig. 4B). As shown previously (15), the basal levels of SP-A, SP-B, SP-C, and SP-D in BALF were unaffected by the deletion of Stat-3 under no stress, 0-h group (Fig. 5). Expression of SP-A, SP-B, and SP-C mRNAs was similar in control and Stat-3
/
mice (15). Two hours after LPS exposure, SP-A and SP-D in BALF were increased in both control and Stat-3
/
mice. In control mice, SP-B content was increased more than twofold following LPS exposure. In Stat-3
/
mice, SP-B was markedly decreased at 2 h, a finding similar to our previous studies with Stat-3
/
mice after hyperoxic lung injury (15). In contrast, SP-C was increased following LPS exposure in both Stat-3
/
and control mice, demonstrating the distinct regulation of Sat PC and SP-B, compared with SP-C.
Stat-3
/
mice are susceptible to IT LPS.
Total protein (Fig. 6A), inflammatory cells (Fig. 6B), and neutrophils (Fig. 6C) in BALF were increased 2 h after LPS injection in both control and Stat-3
/
mice (P < 0.05 vs. 0 h). Total protein in BALF from Stat-3
/
mice was higher than that of control mice (P < 0.05) 16 h after LPS injection, (Fig. 6A), consistent with the sustained increase in protein permeability in the Stat-3
/
mice after LPS. Numbers of macrophages in BALF of control mice were not influenced by LPS injection (P > 0.05), whereas macrophages were significantly increased in Stat-3
/
mice 16 h after LPS injection (Fig. 6D). Proinflammatory cytokines in lung homogenates, including IL-1β (Fig. 7A), IL-6 (Fig. 7B), and MIP-2 (Fig. 7C), were low at 0 h and were increased after LPS injection in both control and Stat-3
/
mice (P < 0.05 vs. 0 h). IL-1β, IL-6, and MIP-2 concentrations peaked at 2 or 4 h and decreased 16 h after injection in control mice. In contrast, IL-1β, IL-6, and MIP-2 in Stat-3
/
mice were higher than in control mice 16 h after LPS injection, suggesting delayed recovery from lung inflammation.
Severity of lung injury after LPS injection in Stat-3
/
mice was demonstrated histologically. Morphological lung injury was evaluated blindly as 0 (no inflammation) to 3 (severe inflammation). Representative histology for each score is shown in Fig. 8 (A–D for Stat-3
/
, E and F for control mice). Lung inflammation was more severe in Stat-3 gene-deleted lung than in control mice lung (Fig. 8G).
Pulmonary dysfunction in Stat-3
/
mice after LPS injection.
IT LPS injection did not influence lung mechanics in control mice. While pulmonary mechanics were unaltered in Stat-3
/
mice under the nonstressed condition, IT injection of LPS resulted in a marked decline in pulmonary function (Fig. 9). Lung compliance was decreased in association with a significant increase in airway resistance, tissue damping, and elastance, consistent with deterioration of surfactant components and tissue edema in Stat-3
/
mice. No differences in hysteresivity were detected, indicating that coupled viscoelasticity of the lung was not influenced in LPS-treated Stat-3
/
mice.
 |
DISCUSSION
|
|---|
The balance among surfactant synthesis, secretion, catabolism, and recycling precisely regulates surfactant pool sizes. Herein, we show that deletion of Stat-3 in respiratory epithelial cells decreased surfactant synthesis and surfactant secretion. In the present study, both Srebf-1 and Akt2 mRNAs were significantly decreased by deletion of Stat-3 in type II epithelial cells in vivo. Sterol regulatory element binding factor, Srebf-1, a gene encoding Srebf-1c, regulates transcription of genes influencing fatty acid and steroid biosynthesis in a process that is known to be influenced by Stat-3 via Akt2 (32, 35, 51). A diagram outlining pathways mediating de novo synthesis of surfactant phospholipid (5) is shown in Fig. 10. A number of the components of this pathway were altered after deletion of Stat-3 in respiratory epithelial cells. Alveolar type II cells utilize phosphate and glucose as a substrate for phospholipid synthesis. Glucose transport is predominantly governed by Glut-1, a member of the glucose transport family (28). Glucose transport regulated by Glut-1 is a rate-limiting step in glucose utilization by isolated rat type II cells (33). Glut-1 is the primary glucose transporter in the lung (46). Slc34a2, the gene for type II bNa/Pi cotransporter, is known to control phosphate readsorption in the renal proximal tubule. Slc34a2 is highly expressed in epithelial type II cells, where it influences phosphate transport associated with surfactant phospholipid synthesis (13, 45). The initial step de novo of surfactant is the catalysis required to glycerolipid synthesis mediated by glycerol-3-phosphate acyltransferase (Gpam). Acox2 encodes acyl-coenzyme A oxidase 2, which catalyzes the formation of phosphatidic acid. Cds2 encodes CDP-diacylglycerol synthase, an enzyme that catalyzes the formation of CDP-diacylglycerol from phosphatidic acid (5). Expression of these key genes regulating phospholipid synthesis was significantly decreased in type II cells isolated from Stat-3
/
mice. Immunohistochemistry for pro-SP-C, a protein expressed only in type II epithelial cells, revealed that there were no changes in the number of type II cells caused by deletion of Stat-3 (15).
Biochemical pathways regulating de novo synthesis of surfactant phospholipid are well known, although the precise transcriptional mechanisms regulating their expression in the lung have not been identified. The present study demonstrates that Stat-3 plays a critical role in surfactant homeostasis in normal and injured lung, regulating expression of genes indicating phospholipid synthesis. Decreased surfactant secretion in Stat-3
/
mice is likely to be caused, at least in part, by decreased ATP-binding cassette A3 (Abca3) expression. Abnormal ultrastructure of lamellar bodies, the surfactant storage organelle, was observed in Stat-3
/
mice previously (26). Abca3 is present in the limiting membranes of the lamellar bodies; mutations in the Abca3 gene cause respiratory distress in newborn infants associated with altered surfactant metabolism and abnormal ultrastructure of lamellar bodies (38, 41).
Previous studies demonstrated that lung compliance and oxygenation were not influenced until >50% of surfactant was removed from alveolus by BAL (16, 22), indicating a reserve of alveolar surfactant. Consistent with these observations, a 40% decrease in BALF Sat PC in Stat-3
/
mice did not influence lung function at baseline. Thus STAT-3 independent mechanism(s) suffices to maintain adequate Sat PC to survive under nonstress conditions. Pulmonary infection caused by gram-negative bacteria is commonly associated with ALI (42, 47). Microbial toxins and LPS, rather than the actual bacterium, can initiate cellular and humoral inflammatory responses. The present study demonstrates that, while respiratory epithelial cell-specific deletion of Stat-3 did not alter lung morphogenesis or function, STAT-3 was required for surfactant homeostasis, including Sat PC synthesis and secretion. SP-B in BALF was significantly decreased in Stat-3
/
mice by LPS injection. Using the conditionally expressing SP-B in Sftpb–/– mice, we have previously shown that the loss of SP-B was sufficient to perturb surfactant function, initiate proinflammatory cytokine expression (IL-6, IL-1β, and MIP-2), and disrupt pulmonary mechanics in the adult lung (20). STAT-3 activates Sftpb expression in vivo and in vitro (53). The normal increase in Sat PC in acute phase of lung injury (2, 9, 31, 48, 50) was not seen in Stat-3
/
mice, and Sat PC in BALF was significantly lower in Stat-3
/
mice. The lower concentration of Sat PC in BALF renders surfactant susceptible to inhibition by plasma proteins (17) that may play a role in the increased LPS-induced lung injury seen in Stat-3
/
mice. In the absence of STAT-3, lung injury induced by LPS was more severe than in control mice, with decreased Sat PC and SP-B leading to respiratory compromise.
Although an increase in activated STAT-3 in ALI has been known (10, 39), the specific roles of STAT-3 in respiratory epithelial cells remain unclear. ALI is a frequent life-threatening disease, resulting in 25–50% mortality in adults and children. ALI is associated with surfactant deficiency and dysfunction (11, 34) caused by factors, including lack of surface-active material; changes in phospholipid, fatty acid, and neutral lipids; and inhibition of surfactant activity related to inflammation and leakage of cellular and serum proteins into the alveolar compartment. In the normal adult lung, surfactant phospholipids and SP-B are increased during the acute phase of lung inflammation in mice, rats, and rabbits (2, 9, 31, 48, 50) and subsequently decrease (21). This induction of surfactant homeostasis during the acute phase of lung injury is required for maintenance of lung function during, and recovery from, ALI. From a clinical perspective, activation of pathways maintaining or increasing STAT-3 in respiratory epithelial cells may provide a strategy for protection of the lung during injury and prevent the lung from ALI.
 |
GRANT
|
|---|
This study was supported by National Heart, Lung, and Blood Institute Grants HL061646, HL038859, and HL084376.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Shawn Grant and Benjamin Feldmann for excellent technical assistance.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: M. Ikegami, Cincinnati Children's Hospital, Div. of Pulmonary Biology, 3333 Burnet Ave., Cincinnati, OH 45229-3039 (e-mail: machiko.Ikegami{at}cchmc.org)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Akira S. IL-6-regulated transcription factors. Int J Biochem Cell Biol 29: 1401–1418, 1997.[CrossRef][Web of Science][Medline]
- Allred TF, Mercer RR, Thomas RF, Deng H, Auten RL. Brief 95% O2 exposure effects on surfactant protein and mRNA in rat alveolar and bronchiolar epithelium. Am J Physiol Lung Cell Mol Physiol 276: L999–L1009, 1999.[Abstract/Free Full Text]
- Alonzi T, Maritano D, Gorgoni B, Rizzuto G, Libert C, Poli V. Essential role of STAT3 in the control of the acute-phase response as revealed by inducible gene inactivation [correction of activation] in the liver. Mol Cell Biol 21: 1621–1632, 2001.[Abstract/Free Full Text]
- Alonzi T, Middleton G, Wyatt S, Buchman V, Betz UA, Muller W, Musiani P, Poli V, Davies AM. Role of STAT3 and PI 3-kinase/Akt in mediating the survival actions of cytokines on sensory neurons. Mol Cell Neurosci 18: 270–282, 2001.[CrossRef][Web of Science][Medline]
- Batenburg JJ. Biosynthesis, secretion, and recycling of surfactant components. In: Surfactant Therapy for Lung Disease, edited by Robertson B and Taeusch HW. New York: Dekker, 1995, p. 47–73.
- Cepkova M, Matthay MA. Pharmacotherapy of acute lung injury and the acute respiratory distress syndrome. J Intensive Care Med 21: 119–143, 2006.[Abstract/Free Full Text]
- Chapman RS, Lourenco PC, Tonner E, Flint DJ, Selbert S, Takeda K, Akira S, Clarke AR, Watson CJ. Suppression of epithelial apoptosis and delayed mammary gland involution in mice with a conditional knockout of Stat3. Genes Dev 13: 2604–2616, 1999.[Abstract/Free Full Text]
- Collins RA, Ikegami M, Korfhagen TR, Whitsett JA, Sly PD. In vivo measurements of changes in respiratory mechanics with age in mice deficient in surfactant protein D. Pediatr Res 53: 463–467, 2003.[CrossRef][Web of Science][Medline]
- D'Angio CT, Finkelstein JN, Lomonaco MB, Paxhia A, Wright SA, Baggs RB, Notter RH, Ryan RM. Changes in surfactant protein gene expression in a neonatal rabbit model of hyperoxia-induced fibrosis. Am J Physiol Lung Cell Mol Physiol 272: L720–L730, 1997.[Abstract/Free Full Text]
- Gao H, Guo RF, Speyer CL, Reuben J, Neff TA, Hoesel LM, Riedemann NC, McClintock SD, Sarma JV, Van Rooijen N, Zetoune FS, Ward PA. Stat3 activation in acute lung injury. J Immunol 172: 7703–7712, 2004.[Abstract/Free Full Text]
- Gregory TJ, Longmore WJ, Moxley MA, Whitsett JA, Reed CR, Fowler AA, Hudson LD, Maunder RJ, Crim C, Hyers TM. Surfactant chemical composition and biophysical activity in acute respiratory distress syndrome. J Clin Invest 88: 1976–1981, 1991.[Web of Science][Medline]
- Hantos Z, Daroczy B, Suki B, Nagy S, Fredberg JJ. Input impedance and peripheral inhomogeneity of dog lungs. J Appl Physiol 72: 168–178, 1992.[Abstract/Free Full Text]
- Hashimoto M, Wang DY, Kamo T, Zhu Y, Tsujiuchi T, Konishi Y, Tanaka M, Sugimura H. Isolation and localization of type IIb Na/Pi cotransporter in the developing rat lung. Am J Pathol 157: 21–27, 2000.[Abstract/Free Full Text]
- Hess HH, Derr JE. Assay of inorganic and organic phosphorus in the 0.1–5 nanomole range. Anal Biochem 63: 607–613, 1975.[CrossRef][Web of Science][Medline]
- Hokuto I, Ikegami M, Yoshida M, Takeda K, Akira S, Perl AK, Hull WM, Wert SE, Whitsett JA. Stat-3 is required for pulmonary homeostasis during hyperoxia. J Clin Invest 113: 28–37, 2004.[CrossRef][Web of Science][Medline]
- Ikegami M, Hesterberg T, Nozaki M, Adams FH. Restoration of lung pressure-volume characteristics with surfactant: comparison of nebulization versus instillation and natural versus synthetic surfactant. Pediatr Res 11: 178–182, 1977.[Web of Science][Medline]
- Ikegami M, Jobe A, Jacobs H, Lam R. A protein from airways of premature lambs that inhibits surfactant function. J Appl Physiol 57: 1134–1142, 1984.[Abstract/Free Full Text]
- Ikegami M, Takabatake N, Weaver TE. Intersubunit disulfide bridge is not required for the protective role of SP-B against lung inflammation. J Appl Physiol 93: 505–511, 2002.[Abstract/Free Full Text]
- Ikegami M, Ueda T, Hull W, Whitsett JA, Mulligan RC, Dranoff G, Jobe AH. Surfactant metabolism in transgenic mice after granulocyte macrophage-colony stimulating factor ablation. Am J Physiol Lung Cell Mol Physiol 270: L650–L658, 1996.[Abstract/Free Full Text]
- Ikegami M, Whitsett JA, Martis PC, Weaver TE. Reversibility of lung inflammation caused by SP-B deficiency. Am J Physiol Lung Cell Mol Physiol 289: L962–L970, 2005.[Abstract/Free Full Text]
- Ingenito EP, Mora R, Cullivan M, Marzan Y, Haley K, Mark L, Sonna LA. Decreased surfactant protein-B expression and surfactant dysfunction in a murine model of acute lung injury. Am J Respir Cell Mol Biol 25: 35–44, 2001.[Abstract/Free Full Text]
- Lewis JF, Tabor B, Ikegami M, Jobe AH, Joseph M, Absolom D. Lung function and surfactant distribution in saline-lavaged sheep given instilled vs. nebulized surfactant. J Appl Physiol 74: 1256–1264, 1993.[Abstract/Free Full Text]
- Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 193: 265–275, 1951.[Free Full Text]
- Martis PC, Whitsett JA, Xu Y, Perl AK, Wan H, Ikegami M. C/EBP
is required for lung maturation at birth. Development 133: 1155–1164, 2006.[Abstract/Free Full Text] - Mason RJ, Nellenbogen J, Clements JA. Isolation of disaturated phosphatidylcholine with osmium tetroxide. J Lipid Res 17: 281–284, 1976.[Abstract]
- Matsuzaki Y, Besnard V, Clark JC, Xu Y, Wert S, Ikegami M, Whitsett J. STAT3 regulates ABCA3 expression and influences lamellar body formation in alveolar type II cells. Am J Respir Cell Mol Biol. In press.
- Matsuzaki Y, Xu Y, Ikegami M, Besnard V, Park KS, Hull WM, Wert SE, Whitsett JA. Stat3 is required for cytoprotection of the respiratory epithelium during adenoviral infection. J Immunol 177: 527–537, 2006.[Abstract/Free Full Text]
- Mueckler M. Facilitative glucose transporters. Eur J Biochem 219: 713–725, 1994.[Web of Science][Medline]
- Naik AS, Kallapur SG, Bachurski CJ, Jobe AH, Michna J, Kramer BW, Ikegami M. Effects of ventilation with different positive end-expiratory pressures on cytokine expression in the preterm lamb lung. Am J Respir Crit Care Med 164: 494–498, 2001.[Abstract/Free Full Text]
- Ng DC, Lin BH, Lim CP, Huang G, Zhang T, Poli V, Cao X. Stat3 regulates microtubules by antagonizing the depolymerization activity of stathmin. J Cell Biol 172: 245–257, 2006.[Abstract/Free Full Text]
- Nogee LM, Wispe JR, Clark JC, Weaver TE, Whitsett JA. Increased expression of surfactant proteins in lungs of oxygen-exposed rats. Am J Respir Cell Mol Biol 4: 102–107, 1991.[Web of Science][Medline]
- Park S, Kim D, Kaneko S, Szewczyk KM, Nicosia SV, Yu H, Jove R, Cheng JQ. Molecular cloning and characterization of the human AKT1 promoter uncovers its up-regulation by the Src/Stat3 pathway. J Biol Chem 280: 38932–38941, 2005.[Abstract/Free Full Text]
- Perez-Diaz J, Martin-Requero A, Ayuso-Parrila MS, Parrilla R. Metabolic features of isolated rat lung cells. I. Factors controlling glucose utilization. Am J Physiol Endocrinol Metab Gastrointest Physiol 232: E394–E400, 1977.[Abstract/Free Full Text]
- Pison U, Seeger W, Buchhorn R, Joka T, Brand M, Obertacke U, Neuhof H, Schmit-Neuerburg KP. Surfactant abnormalities in patients with respiratory failure after multiple trauma. Am Rev Respir Dis 140: 1033–1039, 1989.[Web of Science][Medline]
- Porstmann T, Griffiths B, Chung YL, Delpuech O, Griffiths JR, Downward J, Schulze A. PKB/Akt induces transcription of enzymes involved in cholesterol and fatty acid biosynthesis via activation of SREBP. Oncogene 24: 6465–6481, 2005.[Web of Science][Medline]
- Rice WR, Conkright JJ, Na CL, Ikegami M, Shannon JM, Weaver TE. Maintenance of the mouse type II cell phenotype in vitro. Am J Physiol Lung Cell Mol Physiol 283: L256–L264, 2002.[Abstract/Free Full Text]
- Sano S, Itami S, Takeda K, Tarutani M, Yamaguchi Y, Miura H, Yoshikawa K, Akira S, Takeda J. Keratinocyte-specific ablation of Stat3 exhibits impaired skin remodeling, but does not affect skin morphogenesis. EMBO J 18: 4657–4668, 1999.[CrossRef][Web of Science][Medline]
- Saugstad OD, Hansen TW, Ronnestad A, Nakstad B, Tollofsrud PA, Reinholt F, Hamvas A, Coles FS, Dean M, Wert SE, Whitsett JA, Nogee LM. Novel mutations in the gene encoding ATP binding cassette protein member A3 (ABCA3) resulting in fatal neonatal lung disease. Acta Paediatr 96: 185–190, 2007.[CrossRef][Web of Science][Medline]
- Severgnini M, Takahashi S, Rozo LM, Homer RJ, Kuhn C, Jhung JW, Perides G, Steer M, Hassoun PM, Fanburg BL, Cochran BH, Simon AR. Activation of the STAT pathway in acute lung injury. Am J Physiol Lung Cell Mol Physiol 286: L1282–L1292, 2004.[Abstract/Free Full Text]
- Shimomura I, Shimano H, Horton JD, Goldstein JL, Brown MS. Differential expression of exons 1a and 1c in mRNAs for sterol regulatory element binding protein-1 in human and mouse organs and cultured cells. J Clin Invest 99: 838–845, 1997.[Web of Science][Medline]
- Shulenin S, Nogee LM, Annilo T, Wert SE, Whitsett JA, Dean M. ABCA3 gene mutations in newborns with fatal surfactant deficiency. N Engl J Med 350: 1296–1303, 2004.[Abstract/Free Full Text]
- Sibille Y, Reynolds HY. Macrophages and polymorphonuclear neutrophils in lung defense and injury. Am Rev Respir Dis 141: 471–501, 1990.[Web of Science][Medline]
- Stein PL, Vogel H, Soriano P. Combined deficiencies of Src, Fyn, and Yes tyrosine kinases in mutant mice. Genes Dev 8: 1999–2007, 1994.[Abstract/Free Full Text]
- Takeda K, Noguchi K, Shi W, Tanaka T, Matsumoto M, Yoshida N, Kishimoto T, Akira S. Targeted disruption of the mouse Stat3 gene leads to early embryonic lethality. Proc Natl Acad Sci USA 94: 3801–3804, 1997.[Abstract/Free Full Text]
- Traebert M, Hattenhauer O, Murer H, Kaissling B, Biber J. Expression of type II Na-Pi cotransporter in alveolar type II cells. Am J Physiol Lung Cell Mol Physiol 277: L868–L873, 1999.[Abstract/Free Full Text]
- Wang C, Brennan WA Jr. Rat skeletal muscle, liver and brain have different fetal and adult forms of the glucose transporter. Biochim Biophys Acta 946: 11–18, 1988.[Medline]
- Weiland JE, Davis WB, Holter JF, Mohammed JR, Dorinsky PM, Gadek JE. Lung neutrophils in the adult respiratory distress syndrome. Clinical and pathophysiologic significance. Am Rev Respir Dis 133: 218–225, 1986.[Web of Science][Medline]
- White CW, Greene KE, Allen CB, Shannon JM. Elevated expression of surfactant proteins in newborn rats during adaptation to hyperoxia. Am J Respir Cell Mol Biol 25: 51–59, 2001.[Abstract/Free Full Text]
- Whitsett JA, Weaver TE. Hydrophobic surfactant proteins in lung function and disease. N Engl J Med 347: 2141–2148, 2002.[Free Full Text]
- Wikenheiser KA, Wert SE, Wispe JR, Stahlman M, D'Amore-Bruno M, Singh G, Katyal SL, Whitsett JA. Distinct effects of oxygen on surfactant protein B expression in bronchiolar and alveolar epithelium. Am J Physiol Lung Cell Mol Physiol 262: L32–L39, 1992.[Abstract/Free Full Text]
- Xu Q, Briggs J, Park S, Niu G, Kortylewski M, Zhang S, Gritsko T, Turkson J, Kay H, Semenza GL, Cheng JQ, Jove R, Yu H. Targeting Stat3 blocks both HIF-1 and VEGF expression induced by multiple oncogenic growth signaling pathways. Oncogene 24: 5552–5560, 2005.[CrossRef][Web of Science][Medline]
- Xu Y, Ikegami M, Yanhna W, Matsuzaki Y, Whitsett JA. Gene expression and biological processes influenced by deletion of STAT3 in pulmonary type II cells. BMC Genomics 8: 455, 2007.[CrossRef][Medline]
- Yan C, Naltner A, Martin M, Naltner M, Fangman JM, Gurel O. Transcriptional stimulation of the surfactant protein B gene by STAT3 in respiratory epithelial cells. J Biol Chem 277: 10967–10972, 2002.[Abstract/Free Full Text]
- Zhong Z, Wen Z, Darnell JE. Stat3 and Stat4: members of the family of signal transducers and activators of transcription. Proc Natl Acad Sci USA 91: 4806–4810, 1994.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
Y. Xu, C. Saegusa, A. Schehr, S. Grant, J. A. Whitsett, and M. Ikegami
C/EBP{alpha} is required for pulmonary cytoprotection during hyperoxia
Am J Physiol Lung Cell Mol Physiol,
August 1, 2009;
297(2):
L286 - L298.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Otulakowski, W. Duan, and H. O'Brodovich
Global and Gene-Specific Translational Regulation in Rat Lung Development
Am. J. Respir. Cell Mol. Biol.,
May 1, 2009;
40(5):
555 - 567.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2008 by the American Physiological Society.