J Appl Physiol 103: 2057-2061, 2007.
First published September 20, 2007; doi:10.1152/japplphysiol.00867.2007
8750-7587/07 $8.00
ACE ID genotype affects blood creatine kinase response to eccentric exercise
Chen Yamin,1
Offer Amir,2
Moran Sagiv,1
Eric Attias,1
Yoav Meckel,1
Nir Eynon,1
Michael Sagiv,1 and
Ruthie E. Amir1
1Department of Genetics and Molecular Biology, the Zinman College of Physical Education and Sport Sciences at the Wingate Institute, Netanya; and 2Department of Cardiology, Lady Davis Carmel Medical Center, Haifa, Israel
Submitted 12 August 2007
; accepted in final form 19 September 2007
 |
ABSTRACT
|
|---|
Unaccustomed exercise may cause muscle breakdown with marked increase in serum creatine kinase (CK) activity. The skeletal muscle renin-angiotensin system (RAS) plays an important role in exercise metabolism and tissue injury. A functional insertion (I)/deletion (D) polymorphism in the angiotensin I-converting enzyme (ACE) gene (rs4646994) has been associated with ACE activity. We hypothesized that ACE ID genotype may contribute to the wide variability in individuals' CK response to a given exercise. Young individuals performed maximal eccentric contractions of the elbow flexor muscles. Pre- and postexercise CK activity was determined. ACE genotype was significantly associated with postexercise CK increase and peak CK activity. Individuals harboring one or more of the I allele had a greater increase and higher peak CK values than individuals with the DD genotype. This response was dose-dependent (mean ± SE U/L: II, 8,882 ± 2,362; ID, 4,454 ± 1,105; DD, 2,937 ± 753, ANOVA, P = 0.02; P = 0.009 for linear trend). Multivariate stepwise regression analysis, which included age, sex, body mass index, and genotype subtypes, revealed that ACE genotype was the most powerful independent determinant of peak CK activity (adjusted odds ratio 1.3, 95% confidence interval 1.03–1.64, P = 0.02). In conclusion, we indicate a positive association of the ACE ID genotype with CK response to strenuous exercise. We suggest that the II genotype imposes increased risk for developing muscle damage, whereas the DD genotype may have protective effects. These findings support the role of local RAS in the regulation of exertional muscle injury.
genetics; ACE; insertion/deletion; renin-angiotensin system; eccentric exercise
IT IS WELL ESTABLISHED THAT strenuous exercise may lead to skeletal muscle damage, a condition known as exertional rhabdomyolysis (29, 45). Clinical features include muscle cramps, pain, and a feeling of fatigue accompanied by elevation in levels of serum creatine kinase (CK) following strenuous exercise. In most cases, this muscle damage is repairable without any serious complications and results in muscle adaptation. However, in rare situations, muscle fiber breakdown and the subsequent leakage of muscle contents into blood circulation may lead to renal failure and become a clinically potentially life-threatening condition (22, 29, 51).
Eccentric (muscle lengthening) exercise-induced rhabdomyolysis has been well described (9, 14). However, there is wide variability in both the range of increase in plasma CK and the degree of muscle damage (25, 31) in response to a given exercise. There is growing evidence for a genetic contribution to the phenotypic responses of exertional muscle damage (8, 13).
The renin-angiotensin system (RAS) plays an important role in human body fluid homeostasis and left ventricular remodeling. The angiotensin-converting enzyme (ACE) is a key component in the RAS, generating the vasoconstrictor angiotensin (ANG) II and degrading vasodilator kinins (11). ACE is widely expressed in human tissues, including skeletal muscle, and may play a metabolic role during exercise (20). ANG II has known effects on metabolism (6) and is a recognized growth factor necessary for the hypertrophy of skeletal muscle in response to mechanical load (16). Most of its known physiological and pathophysiological activities are mediated through the ANG II type 1 receptor (AT1R), which is also the only ANG II receptor present in human skeletal muscle (20).
A functional polymorphism of the human ACE gene has been identified in which the presence (insertion: I allele), rather than the absence (deletion: D allele), of a 287-bp Alu repeat element in intron 16 (rs4646994) is associated with lower enzyme activity in both serum and tissue (12, 39), resulting in greater production of ANG II and aldosterone and a decreased half-life of bradykinin (4, 52).
ACE ID polymorphism has been extensively studied in relation to human physical performance. Several reports from European and US Caucasian populations suggested the association of the I and the D alleles with endurance (1, 15, 30–32, 42) and sprint performance (31, 32, 53), respectively. However, some studies in which elite athletes were drawn from diverse sporting disciplines, requiring mixed skills, have failed to demonstrate any association with the ACE genotype (37, 46). Of note, in a different ethnic population of Israeli Caucasians, the ACE DD genotype has been associated with elite endurance athletes (2).
Because there is considerable RAS activity in skeletal muscle that is involved in the regulation of muscle metabolism, vascular tone, and injury responses, we hypothesized that the ACE ID genotype may contribute to the development of exertional rhabdomyolysis and therefore may affect CK response to strenuous exercise. To test our hypotheses, in the present study, we used repetitive eccentric contractions as an exercise model for inducing exertional rhabdomyolysis in healthy young individuals. We investigated the association of ACE ID alleles with CK response to exercise.
 |
MATERIALS AND METHODS
|
|---|
Subjects.
Seventy healthy physical education students (42 men and 28 women; aged 22–32 yr) volunteered for the study. Participants were physically active, but none were well trained or competitive athletes. All were healthy nonsmokers and were not receiving any medical treatment. Exclusion criteria included an occupation that required heavy weight lifting, participating in a resistance training program in the previous 6 mo, baseline blood values outside of the normal range (men: 24–195 U/l; women: 24–170 U/l), known muscle disorders, and any existing myopathy. Participants were all Israeli Caucasians, with an equivalent ratio of Ashkenazi and Non-Ashkenazi descent.
The study was approved by the Institution Review Board (Helsinki Committee) of the "Hillel-Yafe" Medical Center, and all participants gave written, informed consent before inclusion in the study and the start of any study-related procedures.
Eccentric exercise protocol.
Subjects performed one set of 50 maximal eccentric contractions of the elbow flexor muscles of their nondominant arm using the BIODEX dynamometer (BIODEX System 3). Subjects were seated with the arm supported and were stabilized at the waist and the chest. Starting with the elbow flexed to 50° and ending at an angle of 170°, each subject performed 50 maximal eccentric movements of the elbow flexors at 120°/s (each contraction lasted 3 s). During each movement, subjects were verbally encouraged to produce a maximal effort to resist the ability of the dynamometer to extend the elbow. Subjects were given a 10-s rest between each contraction, during which time the dynamometer arm returned passively to the starting position.
Subjects were instructed to drink water before the exercise session and encouraged to maintain hydration and to monitor their urine color throughout the study. They were instructed to call the 24-h study phone to report whether their urine changed from clear or yellow to a brownish color (no subject experienced darkened urine). Subjects were followed-up and instructed not to participate in any strenuous physical activity until their CK values had returned to near normal.
CK analysis.
Blood samples were drawn from an antecubital vein by venipuncture for genotypic analysis and to determine whole blood CK activity pre- and 3, 24, 48, 72, 96, 120, and 168 h postexercise. CK activity was determined by use of a commercially available Reflotron CK assay using the Reflotron system (18).
Genotyping for ACE ID polymorphism.
Genomic DNA was extracted from peripheral blood leukocytes using a standard protocol (40). We used a PCR-based method for genotyping the ACE ID polymorphism, as previously described (26). Briefly, this method yields a PCR fragment of 319 bp and 597 bp in the presence of the D and the I alleles, respectively. PCR fragments were amplified from
20 ng of each DNA sample used as a template in 20-µl polymerase chain reactions (PCR) containing 0.2 U Taq polymerase, 1x reaction buffer, 0.2 mM concentration of each deoxynucleotide triphosphate, and 10 pmol of each of the following primers: GCCCTGCAAGGTGTCTGCAGCATGT (ACE sense) and GGATGGCTCTCCCCGCCTTGTCTC (ACE antisense). The initial denaturation at 95°C for 5 min was followed by 35 cycles of 94°C for 30 s, 58°C annealing for 30 s, and 65°C elongation for 45 s. To avoid misclassification of ID genotypes into DD genotypes, a second PCR was performed using I-specific primers: TGGGACCACAGCGCCCGCCACTAC (I-specific sense) and TCGCCAGCCCTCCCATGCCCATAA (I-specific antisense). This PCR yields a 335-bp fragment only in the presence of the I allele and no product in sample homozygotes for the D allele. Genotyping was performed by experienced staff. PCR scores by two independent investigators who were blind to subject data correlated well (r2 = 0.991).
Data analysis.
The SPSS statistical package version 13.0 was used for statistical evaluation (SPSS, Chicago, IL). Pre- and postexercise CK values were analyzed for their association with ACE genotypes. A
2 test was used to confirm that observed genotype frequencies were in Hardy-Weinberg equilibrium. Normality of each quantitative variable was tested using the Shipiro-Wilk normality test. Genotype subtype comparisons were made by ANOVA and the Kruskal-Wallis test (asymmetrical data distribution). Continuous variables were compared according to genotype group by linear ANOVA. Genotype distribution across levels of CK response was compared by
2 for linear trend. Physiological parameters and genotype data were used in multivariate analysis by the use of forward stepwise regression to determine the model that best predicted CK response to eccentric exercise and to evaluate whether the number of ACE alleles carried by each subject had statistical influence on laboratory parameters. To account for any possible effects of age, sex, or body mass index (BMI), analyses were covaried for these parameters. Asymmetrically distributed variables were log transformed before regression analysis. Continuous data are presented as means ± SD or as means ± SE. Square multiple correlation coefficients (R2) were calculated. Two-tailed values of P < 0.05 were considered statistically significant.
 |
RESULTS
|
|---|
Subjects were 25 ± 3 yr in age, 171 ± 8 cm in height, and 67 ± 10 kg in mass. The data on allele and genotype frequencies in the study population are shown in Table 1. There was no deviation from the Hardy-Weinberg equilibrium (allele frequency ACE I/D = 0.37/0.63, expected genotype frequencies % II/ID/DD = 14%/47%/39%;
2 = 0.03; P = 0.98). Ashkenazi and Non-Ashkenazi descendants did not differ by ACE genotype. There was no relationship of age or body mass to ACE ID genotypes (Table 1). We, like others (8, 17), analyzed both sexes. Of the study population, 42 (60%) were men and 28 (40%) were women, and there was no difference in sex distribution among any of the genotype subtypes (Table 1). CK activity in response to the eccentric exercise regimen for the study population is shown in Fig. 1. Briefly, the baseline CK values were 157 ± 11 U/l (mean ± SE), and the average peak CK activity, which was noted 96 h postexercise (in all subjects), was 4,480 ± 705 U/l (mean ± SE). Sex had no influence on CK response.

View larger version (7K):
[in this window]
[in a new window]
|
Fig. 1. Creatine kinase (CK) activity in response to the eccentric exercise regimen for the study population. Subjects' average serum CK activity at baseline and at different points in time postexercise.
|
|
To determine genotype-phenotype correlations, we compared subjects' phenotypes among ACE genotypes. There was no difference in baseline CK activity in relation to genotype subtypes (Table 2). However, the response to eccentric exercise was genotype dependent. The ACE I allele was significantly associated with peak CK activity as well as with the increase in CK activity (delta CK activity = peak CK activity-baseline CK activity). Individuals harboring one insertion allele (ID) had higher peak values of CK activity and a higher increase in CK activity than individuals having only the deletion allele (DD), and those individuals who had two alleles with the insertion (II) manifested the highest values of peak CK activity and the highest increase in CK activity (Table 2; P = 0.02 for ANOVA, P = 0.009 for linear trend). In a stepwise multivariate linear regression model that included age, sex, BMI, and genotype subtypes, ACE ID polymorphism was the most powerful independent determinant of peak CK activity (adjusted odds ratio = 1.3; 95% confidence interval = 1.03–1.64; P = 0.02).
 |
DISCUSSION
|
|---|
We tested whether ACE ID genotype was associated with skeletal muscle response to strenuous eccentric exercise in healthy young men and women. The major finding of the present study was that individuals with one or more I allele of the ACE gene (ACE II/ID) had a greater increase in CK activity and higher peak CK levels compared with individuals homozygous for the ACE D allele. This response was dose-dependent, since peak CK values were highest in II, intermediate in ID, and lowest in DD genotypes. We suggest that the ACE genotype may influence CK response to eccentric contractions with the ACE II genotype having increased risk for developing exertional rhabdomyolysis. Conversely, it seems that the ACE DD genotype may favorably confer protective effects against exercise-induced muscle injury.
Several potential mechanisms may explain how the ACE genotype influences individuals' CK response to strenuous exercise. The increased ACE activity associated with the DD genotype may lead to enhanced production of ANG II, which is the predominant biological product of RAS, mediating many of the local effects of ACE on skeletal muscle. ANG II is a necessary factor in mediating vascular smooth muscle growth and capillary density in skeletal muscle (20). ANG II has a direct hypertrophic effect on skeletal muscle, and AT1R-mediated ANG II is crucial for optimal overload-induced skeletal muscle hypertrophy (16). Moreover, ANG II has been shown to regulate oxygen consumption and affect muscle energy expenditure (7), and higher maximal oxygen consumption levels have been associated with the ACE D allele (36, 54), indicating an improved oxidative capacity. Although most previous studies associated the ACE I allele (lower ACE activity, high kinin ligand generation, and increased half-life of bradykinin) with increased skeletal muscle metabolic efficiency and perhaps improved contractile function (5, 18, 43, 44), local RAS activity in skeletal muscle is much more complicated. ACE is not only involved in ANG II production and bradykinin degradation, but it also regulates the levels of ANG (1–7) peptide, which is known to cause vasodilating effects (20). Thus it is possible that the protective effects of the ACE D allele against exercise-induced skeletal muscle damage are mainly mediated through the fine tuning of regulating the levels of ANG II and ANG (1–7).
Another explanation for our findings may rely on the mechanisms underlying the process of muscle damage. In exertional rhabdomyolysis, the initial inciting event (whether mechanical stretch or excitation-contraction uncoupling) is accompanied by the uncontrolled movement of Ca2+ into the sarcoplasm, triggering the next stage in the damage process (34, 50). Bradykinin receptor B2 activation can lead to transient rises in inositol 1,4,5-trisphosphate (35), which is involved in excitation-contraction coupling via increases in cytoplasmic Ca2+ (27). Bradykinin stimulates glucose uptake in the presence of insulin, a process related to alteration in intracellular Ca2+ concentration (24). Moreover, data suggest that this process is enhanced by the inhibition of ACE (23). Interestingly, there is evidence that ANG II can affect both sympathetic and neuromuscular transmission (20). Thus it is conceivable that ACE genotype affects CK response via involvement in the regulation of the excitation coupling process.
Heled et al. (17) have recently published a similar study in which no association of ACE genotype with exertional rhabdomyolysis was found. The disagreement between these results and our findings is not uncommon when using population-association studies and may be attributable to different experimental designs and study cohorts. Data suggest that the effect of ACE genotype on physical performance may depend on the type of exercise (28). Moreover, it is well known that the frequencies of the ACE ID alleles vary considerably among different control populations (3), and the influence of varying genetic background may obscure a true association. To support our findings, we have recently demonstrated in Israeli elite athletes an association of the ACE D allele and DD genotype with endurance performance (2). Of note, our individuals were physically active, but none were well trained or competitive athletes. More importantly, they were not engaged in any resistance training programs and were not highly active. Thus it seems that in the Heled et al. study (17) participants were very active and their fitness level was higher than ours. This is also supported by the relatively lower average increase in CK level of their high responders group compared with our average delta CK levels (1,048 vs. 4,480 U/l). Given that fitness level influences the degree of exercise-induced muscle damage (10) and since the effect of ACE polymorphism depends on individuals' fitness levels as well (28), the association between ACE genotype and CK response to exercise may become prominent only in sedentary individuals performing a highly intense effort, as in our study.
Finally, it is still possible that ACE ID polymorphism is one of many genetic variants contributing to the observed variance in muscle CK response or that it is in strong allelic association with functional variants in adjacent genes and that these are responsible for the observed associations with ACE genotype (36). Likewise, it has been proposed that the higher ACE activity associated with the ACE DD genotype (12, 39) is perhaps caused by an Alu-associated transcription silencer (47, 48) or by an identified variant of the of the ACE gene that is in linkage disequilibrium with the Alu insertion/deletion polymorphism (21, 38, 49). However, the medical literature is still debating whether this candidate polymorphism is located in the promoter region (38, 49) or in downstream sequences of the ACE gene (21). The inconsistency regarding ACE haplotypes represents some of the difficulties in studying different populations, and the sequencing of coding and noncoding regions of the ACE gene in other populations with different evolutionary histories may reveal alternative polymorphisms. Rieder et al. (38) found some differences in sequence variation between African-Americans and European-Americans. In his analysis, a major genetic subdivision in the deletion haplotypes was evident only in European-Americans, further supporting the notion that some haplotypes that are present in one population may not apply to other populations. Clearly, more work on large sample sizes is needed to confirm our observations and to better clarify the pathways through which ACE ID genotype associates with exertional muscle damage.
In conclusion, our data suggest a positive association between the ACE genotype and CK response to repetitive eccentric contractions and further support the role of local RAS in the regulation of exertional muscle injury.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: R. Amir, Director, Dept. of Genetics and Molecular Biology, Zinman College of Physical Education and Sport Sciences at the Wingate Institute, Netanya 42902, Israel (e-mail: ruthieam{at}012.net.il)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Alvarez R, Terrados N, Ortolano R, Iglesias-Cubero G, Reguero JR, Batalla A, Cortina A, Fernandez-Garcia B, Rodriguez C, Braga S, Alvarez V, Coto E. Genetic variation in the renin-angiotensin system and athletic performance. Eur J Appl Physiol 82: 117–120, 2000.[CrossRef][Web of Science][Medline]
- Amir O, Amir R, Yamin C, Attias E, Eynon N, Sagiv M, Sagiv M, Meckel Y. Human, environmental & exercise: the ACE deletion allele is associated with Israeli elite endurance athletes. Exp Physiol 92: 881–886, 2007.[Abstract/Free Full Text]
- Barley J, Blackwood A, Carter ND, Crews DE, Cruickshank JK, Jeffery S, Ogunlesi AO, Sagnella GA. Angiotensin converting enzyme insertion/deletion polymorphism: association with ethnic origin. J Hypertens 12: 955–957, 1994.[Web of Science][Medline]
- Baudin B. New aspects on angiotensin-converting enzyme: from gene to disease. Clin Chem Lab Med 40: 256–265, 2002.[CrossRef][Web of Science][Medline]
- Boushel R, Langberg H, Gemmer C, Olesen J, Crameri R, Scheede C, Sander M, Kjaer M. Combined inhibition of nitric oxide and prostaglandins reduces human skeletal muscle blood flow during exercise. J Physiol 543: 691–698, 2002.[Abstract/Free Full Text]
- Brink M, Wellen J, Delafontaine P. Angiotensin II causes weight loss and decreases circulating insulin-like growth factor I in rats through a pressor-independent mechanism. J Clin Invest 97: 2509–2516, 1996.[Web of Science][Medline]
- Cassis L, Helton M, English V, Burke G. Angiotensin II regulates oxygen consumption. Am J Physiol Regul Integr Comp Physiol 282: R445–R453, 2002.[Abstract/Free Full Text]
- Clarkson PM, Hoffman EP, Zambraski E, Gordish-Dressman H, Kearns A, Hubal M, Harmon B, Devaney JM. ACTN3 and MLCK genotype associations with exertional muscle damage. J Appl Physiol 99: 564–569, 2005.[Abstract/Free Full Text]
- Clarkson PM, Nosaka K, Braun B. Muscle function after exercise-induced muscle damage and rapid adaptation. Med Sci Sports Exerc 24: 512–520, 1992.
- Close GL, Kayani A, Vasilaki A, Mcardle A. Skeletal muscle damage with exercise and aging. Sports Med 35: 413–427, 2005.[CrossRef][Web of Science][Medline]
- Coates D. The angiotensin converting enzyme (ACE). Int J Biochem Cell Biol 35: 769–773, 2003.[CrossRef][Web of Science][Medline]
- Danser AH, Schalekamp MADH, Bax WA, van den Brink MA, Saxena PR, Riegger GAJ, Schunkert H. Angiotensin-converting enzyme in the human heart. Effect ofthe deletion/insertion polymorphism. Circulation 92: 1387–1388, 1995.[Abstract/Free Full Text]
- Devaney JM, Hoffman EP, Gordish-Dressman H, Kearns A, Zambraski E, Clarkson PM. IGF-II gene region polymorphisms related to exertional muscle damage. J Appl Physiol 102: 1815–1823, 2007.[Abstract/Free Full Text]
- Evans RK, Knight KL, Draper DO, Parcell AC. Effects of warm-up before eccentric exercise on indirect markers of muscle damage. Med Sci Sports Exerc 34: 1892–1899, 2002.
- Gayagay G, Yu B, Hambly B, Boston T, Hahn A, Celermajer DS, Trent RJ. Elite endurance athletes and the ACE I allele: the role of genes in athletic performance. Hum Genet 103: 48–50, 1998.[CrossRef][Web of Science][Medline]
- Gordon S, Davis BS, Carlson CJ, Botth FW. Ang II is required for optimal overload-induced skeletal muscle hypertrophy. Am J Physiol Endocrinol Metab 280: E150–E159, 2001.[Abstract/Free Full Text]
- Heled Y, Bloom MS, Wu TJ, Stephens Q, Deuster PA. CM-MM and ACE genotypes and physiological prediction of the creatine kinase response to exercise. J Appl Physiol 103: 504–10, 2007.[Abstract/Free Full Text]
- Henriksen EJ, Jacob S, Kinnick TR, Youngblood EB, Schmit MB, Dietze GJ. ACE inhibition and glucose transport in insulin resistant muscle: roles of bradykinin and nitric oxide. Am J Physiol Regul Integr Comp Physiol 277: R332–R336, 1999.[Abstract/Free Full Text]
- Hørder M, Jorgensen PJ, Hafkenscheid JC, Carstensen CA, Bachmann C, Bauer K, Neuwald C, Rosalki SB, Foo AY, Vogt W. Creatine kinase determination: a European evaluation of the creatine kinase determination in serum, plasma and whole blood with the Reflotron system. Eur J Clin Chem Clin Biochem 29: 691–696, 1999.
- Jones A, Woods DR. Skeletal muscle RAS and exercise performance. Int J Biochem Cell Biol 35: 855–866, 2003.[CrossRef][Web of Science][Medline]
- Keavney B, Mckenzie CA, Connell JMC, Julier C, Ratcliffe PJ, Sobel E, Lathrop M, Farrall M. Measured haplotype analysis of the angiotensin-I converting enzyme gene. Hum Mol Genet 7: 1745–1751, 1998.[Abstract/Free Full Text]
- Knochel JP. Catastrophic medical events with exhaustive exercise: "white collar rhabdomyolysis." Kidney Int 38: 709–719, 1990.[Web of Science][Medline]
- Kudoh A, Dietze GJ, Rabito SF. Insulin enhances the bradykinin response in L8 rat skeletal myoblasts. Diabetes 49: 190–194, 2000.[Abstract]
- Kudoh A, Matsuki A. Effects of angiotensin-converting enzyme inhibitors on glucose uptake. Hypertension 36: 239–244, 2000.[Abstract/Free Full Text]
- Lin AC, Lin CM, Wang TL, Leu JG. Rhabdomyolysis in 119 students after repetitive exercise. Br J Sports Med 39: e3, 2005.[Abstract/Free Full Text]
- Lindpaintner K, Pfeffer MA, Kreutz R, Stampfer MJ, Grodstein F, LaMotte F, Buring J, Hennekens CH. A prospective evaluation of an angiotensin-converting-enzyme gene polymorphism and the risk of ischemic heart disease. N Engl J Med 332: 706–711, 1995.[Abstract/Free Full Text]
- Lopez JR, Parra L. Inositol 1,4,5-trisphosphate increases myoplasmic [Ca2+] in isolated muscle fibers. Depolarization enhances its effects. Cell Calcium 12: 543–557, 1991.[CrossRef][Web of Science][Medline]
- Lucía A, Gómez-Gallego F, Chicharro JL, Hoyos J, Celaya K, Córdova A, Villa G, Alonso JM, Barriopedro M, Pérez M, Earnest CP. Is there an association between ACE and CKMM polymorphisms and cycling performance status during 3-week races? Int J Sports Med 26: 442–447, 2005.[CrossRef][Web of Science][Medline]
- Milne CJ. Rhabdomyolysis, myoglobinuria and exercise. Sports Med 6: 93–106, 1988.[Web of Science][Medline]
- Montgomery HE, Marshall R, Hemingway H, Myerson S, Clarkson P, Dollery C, Hayward M, Holliman DE, Jubb M, World M, Thomas EL, Brynes AE, Saeed N, Barnard M, Bell JD, Prasad K, Rayson M, Talmud PJ, Humphries SE. Human gene for physical performance. Nature 393: 221–222, 1998.[CrossRef][Medline]
- Myerson S, Hemingway H, Budget R, Martin J, Humphries S, Montgomery H. Human angiotensin I-converting enzyme gene and endurance performance. J Appl Physiol 87: 1313–1316, 1999.[Abstract/Free Full Text]
- Nazarov IB, Woods DR, Montgomery HE, Shneider OV, Kazakov VI, Tomilin NV, Rogozkin VA. The angiotensin converting enzyme I/D polymorphism in Russian athletes. Eur J Hum Genet 9: 797–801, 2001.[CrossRef][Web of Science][Medline]
- Noaks TD. Effect of exercise on serum enzyme activities in humans. Sports Med 4: 245–267, 1987.[Web of Science][Medline]
- Proske U, Allen TJ. Damage to skeletal muscle from eccentric exercise. Exerc Sport Sci Rev 33: 98–104, 2005.[CrossRef][Web of Science][Medline]
- Rabito SF, Minshall RD, Nakamura F, Wang LX. Bradykinin B2 receptors on skeletal muscle are coupled to inositol 1,4,5-trisphosphate formation. Diabetes 45, Suppl 1: 29–33, 1996.
- Rankinen T, Perusse L, Gagnon J, Chagnon YC, Leon AS, Skinner JS, Wilmore JH, Rao DC, Bouchard C. Angiotensin-converting enzyme ID polymorphism and fitness phenotype in the HERITAGE Family Study. J Appl Physiol 88: 1029–1035. 2000.[Abstract/Free Full Text]
- Rankinen T, Wolfarth B, Simoneau JA, Maier-Lenz D, Rauramaa R, Rivera MA, Boulay MR, Chagnon YC, Perusse L, Keul J, Bouchard C. No association between the angiotensin-converting enzyme ID polymorphism and elite endurance athlete status. J Appl Physiol 88: 1571–1575, 2000.[Abstract/Free Full Text]
- Rieder MJ, Taylor SL, Clark AG, Nickerson DA. Sequence variation in the human angiotensin converting enzyme. Nat Genet 22: 59–62, 1999.[CrossRef][Web of Science][Medline]
- Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 86: 1343–1346, 1990.[Web of Science][Medline]
- Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning. Cold Spring Harbor, NY: Cold Spring Harbor, 1989.
- Sayers SP, Clarkson PM, Rouzier PA, Kamen G. Adverse events associated with eccentric exercise protocols: six case studies. Med Sci Sports Exerc 31: 1697–1702, 1999.
- Scanavini D, Bernardi F, Castoldi E, Conconi F, Mazzoni G. Increased frequency of the homozygous II ACE genotype in Italian Olympic endurance athletes. Eur J Hum Genet 10: 576–577, 2002.[CrossRef][Web of Science][Medline]
- Shen W, Hintze TH, Wolin Nitric oxide MS. An important signaling mechanism between vascular endothelium and parenchymal cells in the regulation of oxygen consumption. Circulation 92: 3505–3512, 1995.[Abstract/Free Full Text]
- Shiuchi T, Nakagami H, Iwai M, Takeda Y, Cui T, Chen R, Minokoshi Y, Horiuchi M. Involvement of bradykinin and nitric oxide in leptin-mediated glucose uptake in skeletal muscle. Endocrinology 142: 608–612, 2001.[Abstract/Free Full Text]
- Sinert R, Kohl L, Rainone T, Scalea T. Exercise-induced rhabdomyolysis. Ann Emerg Med 23: 1301–1306, 1994.[Web of Science][Medline]
- Taylor RR, Mamotte CD, Fallon K, van Bockxmeer FM. Elite athletes and the gene for angiotensin-converting enzyme. J Appl Physiol 87: 1035–1037, 1999.[Abstract/Free Full Text]
- Tomilin NV, Iguchi-Ariga SM, Ariga H. Transcription and replication silencer element is present within conserved region of human Alu repeats interacting with nuclear protein. FEBS Lett 263: 69–72, 1990.[CrossRef][Web of Science][Medline]
- Tomilin NV. Control of genes by mammalian retroposons. Int Rev Cytol 186: 1–48, 1990.
- Villard E, Tiret L, Visvikis S, Rakotovao R, Cambien F, Soubrier F. Identification of new polymorphisms of the angiotensin I-converting enzyme (ACE) gene, and study of their relationship to plasma ACE levels by two-QTL segregation-linkage analysis. Am J Hum Genet 58: 1268–1278, 1996.[Web of Science][Medline]
- Warren GL, Ingalls CP, Lowe DA, Armstrong RB. Excitation-contraction uncoupling: major role in contraction-induced muscle injury. Exerc Sport Sci Rev 29: 82–87, 2001.[CrossRef][Medline]
- Warren JD, Blumbergs PC, Thompson PD. Rhabdomyolysis: a review. Muscle Nerve 25: 332–347, 2002.[CrossRef][Web of Science][Medline]
- Williams AG, Dhamrait SS, Wootton PT, Day SH, Hawe E, Payne JR, Myerson SG, World M, Budgett R, Humphries SE, Montgomery HE. Bradykinin receptor gene variant and human physical performance. J Appl Physiol 96: 938–942, 2004.[Abstract/Free Full Text]
- Woods D, Hickman M, Jamshidi Y, Brull D, Vassiliou V, Jones A, Humphries S, Montgomery H. Elite swimmers and the D allele of the ACE I/D polymorphism. Hum Genet 108: 230–232, 2001.[CrossRef][Web of Science][Medline]
- Zhao B, Moochhala SM, Tham S, Lu J, Chia M, Byrne C, Hu Q, Lee LK. Relationship between angiotensin-converting enzyme ID polymorphism and
O2 max of Chinese males. Life Sci 73: 2625–2630, 2003.[CrossRef][Web of Science][Medline]
Copyright © 2007 by the American Physiological Society.