J Appl Physiol 103: 1412-1418, 2007.
First published August 2, 2007; doi:10.1152/japplphysiol.00288.2007
8750-7587/07 $8.00
Expression and activity of cyclooxygenase isoforms in skeletal muscles and myocardium of humans and rodents
Marco Testa,1
Bianca Rocca,2
Lucia Spath,3
Franco O. Ranelletti,4
Giovanna Petrucci,4
Giovanni Ciabattoni,5
Fabio Naro,3
Stefano Schiaffino,6
Massimo Volpe,1,7,8 and
Carlo Reggiani9
1Department of Cardiology, Sant'Andrea Hospital, Departments of 2Pharmacology and 7Cardiology, II School of Medicine, University of Rome "La Sapienza," 3Department of Histology, I School of Medicine, University of Rome "La Sapienza," 4Department of Pathology, Catholic University, Rome; 5Department of Pharmacy, University of Chieti, Chieti; 8IRCCS Neuromed, Pozzilli; and Departments of 6Biomedical Sciences and 9Human Anatomy and Physiology, University of Padua, Padua, Italy
Submitted 13 March 2007
; accepted in final form 11 July 2007
 |
ABSTRACT
|
|---|
Conflicting data have been reported on cyclooxygenase (COX)-1 and COX-2 expression and activity in striated muscles, including skeletal muscles and myocardium, in particular it is still unclear whether muscle cells are able to produce prostaglandins (PGs). We characterized the expression and enzymatic activity of COX-1 and COX-2 in the skeletal muscles and in the myocardium of mice, rats and humans. By RT-PCR, COX-1 and COX-2 mRNAs were observed in homogenates of mouse and rat hearts, and in different types of skeletal muscles from all different species. By Western blotting, COX-1 and -2 proteins were detected in skeletal muscles and hearts from rodents, as well as in skeletal muscles from humans. Immunoperoxidase stains showed that COX-1 and -2 were diffusely expressed in the myocytes of different muscles and in the myocardiocytes from all different species. In the presence of arachidonic acid, which is the COX enzymatic substrate, isolated skeletal muscle and heart samples from rodents released predominantly PGE2. The biosynthesis of PGE2 was reduced between 50 and 80% (P < 0.05 vs. vehicle) in the presence of either COX-1- or COX-2-selective blockers, demonstrating that both isoforms are enzymatically active. Exogenous PGE2 added to isolated skeletal muscle preparations from rodents did not affect contraction, whereas it significantly fastened relaxation of a slow type muscle, such as soleus. In conclusion, COX-1 and COX-2 are expressed and enzymatically active in myocytes of skeletal muscles and hearts of rodents and humans. PGE2 appears to be the main product of COX activity in striated muscles.
muscle; myocardium; prostaglandins; cyclooxygenases
PROSTANOIDS DERIVE FROM ARACHIDONIC ACID (AA) through the sequential enzymatic activity of cyclooxygenases (COX)-1 or -2 and of terminal synthases. Both COX-1 and -2 catalyze the conversion of AA into an unstable intermediate, the prostaglandin (PG) G/H2, which is then transformed by distinct terminal synthases into PGE2, PGF2, thromboxane (Tx) A2, PGD2, or PGI2.
COX-1 and COX-2, are encoded by different genes, are highly homologous, and catalyze the same reaction, although they play different roles even within the same cell or tissue (28). The role of COX-1 or -2 and of different prostanoids in hemostasis, reproduction, kidney function, gastric protection, and inflammation are well known. TxA2 is a vasoconstrictor and pro-aggregatory agent, PGI2 is a vasodilating and endothelium-protective compound, and PGE2 mediates inflammation (21). On the contrary, the possible presence and function of COX and prostanoids in striated muscles are less defined. More than 20 years ago, Young and Sparks (35) observed that skeletal muscles could release PGE2, and similar data were reported by Rodemann and Goldberg (22). Physical exercise has been shown to increase PGE2 synthesis in normal muscles (10, 31, 32). Elevated PGE2 synthesis has been documented in muscles from patients with Duchenne muscular dystrophy or from mdx mice (9, 13), as well as in regenerating skeletal muscles of rodents (12). Nevertheless, it remains presently unknown whether muscle fibers or other cell types (fibroblasts, macrophages, cells of the vessel wall) account for PG release and which COX isoform is present in striated muscles, both myocardial and skeletal. Furthermore, PGs function in the pathophysiology of muscle contraction, differentiation, and regeneration remains unclear.
We sought to characterize the pattern of expression of each COX isoform in striated muscles, including different skeletal muscles and myocardium, from three different species: mouse, rat, and human. Together with the expression, we also investigated the selective activity of each COX isoform as well as the effects of the major product of COX activity on a rodent's muscle contraction.
 |
MATERIALS AND METHODS
|
|---|
Tissue sampling.
Skeletal muscles and hearts were obtained from adult Wistar rats (weighing 130–160 g) and adult CD1 mice (weighing 45–60 g). Briefly, under deep anesthesia, animals were exsanguinated by carotid cutting and then killed by cervical dislocation. Heart, intact soleus, and extensor digitorum longus (EDL) with short pieces of tendons were excised. Small biopsies of normal human skeletal muscles were obtained during orthopedic surgery after informed consent of patients was obtained. For mRNA studies, tissue samples were immediately frozen in liquid nitrogen and kept at –80°C until use. For immunohistochemistry, tissue samples were immediately mounted in OCT, frozen in liquid nitrogen, and kept at –80°C until use or were immediately placed into buffered formalin and then embedded in paraffin using standard procedures. Human heart samples were obtained from paraffinated samples of the Archives of the Pathology Department, originated from postmortem hearts in subjects who died from noncardiac causes.
The animals were treated according to the Convention of Helsinki on the utilization of animals in biomedical research and according to the guidelines of the American Physiological Society. All experiments were approved by the Ethical Commission of the Department of Anatomy and Physiology, University of Padova.
RNA preparation.
Total RNA was isolated from frozen tissues by homogenization in Trizol Reagent (Life Technologies, Gaithersburg, MD) following the manufacturer's protocol. One microgram of total RNA was reverse transcribed using Moloney murine leukemia virus RT (GIBCO-Invitrogen, Carlsbad CA). PCR reactions were carried out by standard technique using Taq PCRx DNA Polymerase (GIBCO-Invitrogen, Carlsbad, CA) under the following conditions: denaturation at 95°C for 30 s, annealing at 50–55°C (for different amplifications) for 30 s, and extension at 68°C for 40 s after the initial denaturation at 95°C for 2 min (35 cycles). The following oligonucleotides were used to amplify COX-1, COX-2 and
-actin cDNA: human COX-1 (forward 5'ttcttgctgttcctgctcctg3'; reverse 5'gcattgacaaactcccagaac3'); human COX-2 (forward 5'tcctggcgctcagccataca3'; reverse 5'gtagccatagtcagcattgta3'); mouse COX-1 (forward 5'ggtcctgctcgcagatcctg3'; reverse 5'aggacccatctttccagagg3'); mouse COX-2 (forward 5'ctgtacaagcagtggcaa3'; reverse 5'ttacagctcagttgaacgcct3'); rat COX-1 (forward 5'CCTTCCGTGTGCCAGATTAC3'; reverse 5'GGCTGGCCTAGAACTCACTG3'); rat COX-2 (forward 5'ACACTCTATCACTGGCATCC3'; reverse 5'GAAGGGACACCCTTTCACAT3');
-actin (forward 5'accaactgggacgacatggag3'; reverse 5'gactacctcatgaagatcctgacc3'). Integrity and equal loading of cDNA in the PCR reactions were checked by quantification of
-actin. The expected sizes of the amplicons were: 580 base pairs (bp) for mouse COX-1; 530 bp for mouse COX-2; 475 bp for rat COX-1; 585 bp for rat COX-2; 286 bp for human COX-1; 334 bp for human COX-2, 380 bp for mouse, rat, and human actin.
Western blotting.
Frozen muscles were homogenized in ice-cold RIPA buffer (10 mM Tris·HCl, pH 7.5, 10 mM EDTA, 0.5 M NaCl, 1% NP40) containing a protease inhibitors cocktail (Roche Molecular Biochemicals, Manneim, Germany). Protein (30 µg) were separated by SDS-PAGE on a 8% polyacrylamide gel, blotted onto a nitrocellulose membrane, and probed with anti-COX-1 and anti-COX-2 monoclonal antibodies (Cayman Chemicals, Ann Arbor, MI). Proteins were assayed by the Bradford method. To verify equal loading, the blotted membrane were probed also with anti-tubulin or actin monoclonal antibodies (Sigma-Aldrich, St. Louis, MO), as specified. After incubation with peroxidase-conjugated anti-rabbit or anti-mouse IgG (Sigma-Aldrich), reactions were revealed with the ECL reagent (Amersham, Arlington Heights, IL). Densitometric analysis of the bands were performed by a Diana 95.1 camera (Raytest Isotopenmebgerate, Straubenhardt, Germany) and analyzed by the Aida 2.1 software (Raytest Isotopenmebgerate).
Immunohistochemistry.
Tissue slides were rehydrated, treated with 0.3% H2O2 in methanol for 10 min to block endogenous peroxidase and incubated for 1 h with one of the following primary Abs: monoclonal BA-D5 (25) specific for type I skeletal muscle fibers, monoclonal SC-71, specific for type IIa skeletal muscle fibers (25), anti-COX-1 polyclonal Ab (Cayman Chemicals, Ann Arbor, MI), anti-COX-2 polyclonal Ab (Cayman Chemicals). Rabbit and/or mouse preimmune IgGs were used as negative controls. Indirect immunoperoxidase stainings were performed using the ABC-peroxidase technique (Vector Laboratories, Burlingame, CA) developed with the DAB substrate kit (Vector Laboratories).
COX activity and inhibitor studies.
Immediately after excision, soleus, EDL, and small fragments of myocardium (15–20 mg) were washed twice in Krebs-Henseleit buffer (Sigma-Aldrich) to eliminate blood and transferred to incubation chamber. Rat and mouse skeletal muscles were mounted and gently stretched to maintain them at 100% of their resting length. Every incubation was carried out in 1 ml of medium, equilibrated with 95% O2-5% CO2 before use, and kept at 37°C under 95% O2-5% CO2 throughout the experiment. All muscles were incubated following the same protocols.
To assess COX activity, skeletal muscles were subjected to two subsequent incubations of 30 min each. After the last incubation, the medium was removed and frozen for prostanoids measurements. In different experiments, skeletal muscles and myocardium were preincubated for 30 min with Krebs buffer, preincubation medium was then removed, and the same buffer with 20 µM AA was added for 30 min, and the supernatants were frozen.
In experiments with COX inhibitors, samples were preincubated for 30 min with Krebs buffer containing 20 µM indomethacin (a nonselective COX-1 and -2 inhibitor), 100 nM SC-560 (a selective COX-1 inhibitor), 100 nM NS-398 (a selective COX-2 inhibitor) (all from Cayman Chemicals), or vehicle; medium was then removed and the same buffer containing 20 µM AA and the correspondent inhibitor or vehicle were incubated for 30 min. At the end of any incubation, medium was collected and frozen for prostanoid measurements.
Determination of PGE2 and TxB2.
PGE2 and TxB2 were determined in the medium of muscle incubation by using previously validated radioimmunoassays (2).
Muscle contraction studies.
Murine soleus and EDL muscles were dissected and transferred to the myograph, where they were mounted between the hook of a force transducer (AME 801; Aksjeselkapet Mikkroelektronik, Norway) and a hook connected to a movable shaft used to adjust muscle length. Muscles were tied to the hooks by means of silk threads that had been previously fixed to the tendons. The perfusion bath (2 ml) was filled with bicarbonate Krebs solution, bubbled with a O2-CO2 mixture kept at constant temperature (25°C). The perfusing solution could be quickly renewed (5–10 s) by flushing through the chamber
20 ml of the new solution. On both sides of the perfusion bath at a distance of
2 mm from the preparations, plate platinum electrodes connected with a Grass stimulator allowed field electrical stimulation. The preparations were stretched just above slack length, and their response to electrical stimulation was tested. Each preparation was stimulated for
30 min with supramaximal, low-frequency (0.1 Hz) stimuli. The influence of PGE2 (between 100 nM and 10 µM) on the parameters of the isometric twitch (peak tension, time to peak and time to half relaxation) was investigated. The concentrations used were in the range previously used in vitro by other authors on airway smooth muscles (30) and myometrium (18). The output of the tension transducer was stored in a personal computer after analog-to-digital conversion and was recalled for analysis. Cambridge Electronic Design 1401 analog-to-digital converter and CEA Spike2 software (CED, Cambridge, UK) were used.
Statistical analysis.
Values are reported as means ± SD or SE, as indicated. Statistical significance of the differences between means was assessed by analysis of variance followed by the Student-Newman-Keuls test or by Student's t-test for paired or nonpaired data, as indicated. Statistical significance was set at P < 0.05.
 |
RESULTS
|
|---|
COX expression and activity in skeletal muscles.
Messenger RNAs for COX-1 and COX-2 were detected in samples from different muscle types of mice, rats, and humans (Fig. 1). Consistently, Western blots showed immunoreactive COX-1 and COX-2 of the expected size (i.e.,
70 kDa) in muscle homogenates from rat, mouse, and human samples (Fig. 2, A and B). Densitometric analysis of the Western-blot bands, expressed as ratios of COX-1 or -2 vs. tubulin bands, showed no major differences in levels of protein expression among different types of muscles within the same species, including predominantly slow (soleus), fast (EDL, tibialis anterior), or mixed (diaphragm, rectus abdominis) muscles (Fig. 2, C and D).

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 1. Expression of mRNA for cyclooxygenase (COX)-1 and -2 in striated muscles and in the heart. RT-PCR samples amplified with primers for COX-1, COX-2, or actin in mouse, rat, or human samples, as indicated. EDL, extensor digitorum longus; H, heart; K, kidney (positive control); mw, molecular weight markers; RA, rectus abdominis; Sol, soleus. The amplified fragments were of the expected molecular weight (see MATERIALS AND METHODS for details).
|
|

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 2. Expression of COX-1 and -2 proteins in rodent and human striated muscles. A and B: Western blots of mouse, rat, or human samples detected with anti COX-1, anti COX-2, or anti-tubulin antibodies, as indicated (see MATERIALS AND METHODS for details). C and D: densitometric analyses of Western blot bands for COX-1, COX-2, and tubulin of different muscles. Data are expressed as ratios vs. tubulin band intensities, and are means ± SD of at least 3 different determinations. No significant variations were observed for either COX-1 or COX-2 expression among different muscles of the same species. Dia, diaphragm. TA, tibialis anterior; tub, tubulin.
|
|
To identify the cells expressing COX isoenzymes, samples of skeletal muscles were studied by immunohistochemistry using specific antibodies. COX-1 and COX-2 immunoreactivity was consistently observed in muscle fibers of rodents (Figs. 3 and 4, A and B) and humans (Figs. 5, A and B). In the same specimens, vascular smooth muscle cells, interstitial fibroblasts, adipocytes (if present), and endothelial cells of veins and smallest arteries were negative for either COX-1 or -2, whereas endothelial cells of larger arteries, identified by a thicker media, were positive for COX-1 and COX-2. This pattern was consistent among all different species. We studied different types of muscles, and the expression of both COX-1 and -2 protein was similar. To further assess whether COX isoenzymes had any preferential expression in different types of fibers, serial sections of rodent and human muscles were stained with antibodies specific for type I fibers, type IIa fibers, COX-1, or COX-2. No preferential expression of COX isoenzymes in either type I or type IIa fibers was detected (Figs. 3–5, C and D).

View larger version (139K):
[in this window]
[in a new window]
|
Fig. 3. Immunoperoxidase staining of serial samples of rat soleus. A: COX-1. B: COX-2. C: type I myosin. D: type IIa myosin. Negative fibers are visibile in C and D. Original magnification = x20.
|
|

View larger version (153K):
[in this window]
[in a new window]
|
Fig. 4. Immunoperoxidase staining of serial samples of mouse soleus. A: COX-1. B: COX-2. C: type I myosin. D: type IIa myosin. Negative fibers are visibile in C and D. Original magnification = x20.
|
|

View larger version (144K):
[in this window]
[in a new window]
|
Fig. 5. Immunoperoxidase staining of serial samples of human rectus abdominis. A: COX-1. B: COX-2. C: type I myosin. D: type IIa myosin. Negative fibers are visibile in C and D. Original magnification = x20.
|
|
We next investigated the enzymatic activity of COX isoenzymes in striated muscles. In a first set of experiments using soleus and EDL from mouse and rat, we observed that muscles released both PGE2 and TxB2, with PGE2 being approximately six times more abundant than TxB2 in both species (for example: rat EDL released 9.4 ± 3.3 pg/mg of tissue of PGE2 and 0.9 ± 0.08 pg/mg of tissue of TXB2; rat soleus released 6.5 ± 1.9 pg/mg of tissue of PGE2 and 1.9 ± 0.9 pg/mg of tissue of TxB2; n = 3 each determination). Thereafter, we measured PGE2 released in 30-min incubation (Fig. 6). The amounts of PGE2 released by rat and mouse muscles were four to five times higher in the presence of AA loaded to the medium (rat EDL: 10.3 ± 3.6 vs. 1.4 ± 0.6 pg/mg muscle, with and without AA, respectively, n = 4; mouse soleus: 43 ± 14 vs. 13 ± 9 pg/mg muscle, with and without AA, respectively, n = 4). The predominance of PGE2 indirectly demonstrated that muscle specimens were properly washed and depleted of blood and platelets, with TxA2 being the main platelet-derived product instead (21). The amount of PGE2 released from mouse soleus and EDL, normalized for muscle's weight, was five to eight times higher than that released from rat muscles (Fig. 6). This difference might be attributed to the different thickness of the muscles in the two species. Taking into account the size of the rat muscles, it is likely that not the whole muscles but only the outer layers of the muscles could release the prostanoid into the incubation medium.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 6. PGE2 released from rat (A) and mouse (B) muscles. PGE2 released in 30 min from soleus and EDL of rat and mouse was measured in the medium with 20 µM AA loading in the presence of vehicle, indomethacin, SC-560, or NS-398 (see MATERIALS AND METHODS for details). The amount of PGE2 was normalized to muscle weight. Black bars indicate soleus muscle; white bars indicate EDL muscle. Data are means ± SD of 4–6 experiments in duplicate. *P < 0.01 vs. vehicle.
|
|
To discriminate the relative contribution of each COX isoform to PGE2 formation, muscle samples were preincubated with the nonselective inhibitor indomethacin, the COX-1-selective inhibitor SC-560, or the COX-2-selective inhibitor NS-398. Among the three different inhibitors, indomethacin (20 µM) showed the higher degree of inhibition of PGE2 in both species and in all the muscles examined, as shown in Fig. 6. At variance with indomethacin, SC-560 and NS-398 at concentrations known to be isoform selective such as 100 nM, caused a lower degree of inhibition of PGE2 synthesis. Dose response experiments showed similar degrees of inhibition between 100 nM and 1 µM of both SC-560 and NS-398, indicating that each isoform was maximally inhibited at those concentrations (data not shown). We did not check concentrations higher than 1 µM because drug selectivity is lost by increasing the concentrations (20). These experiments indicate that both COX isoforms are enzymatically active and contribute to PGE2 synthesis in rodents, although COX-1 inhibition consistently gave a higher degree of PGE2 reduction compared with COX-2 inhibition (Fig. 6).
In vitro effects of exogenous PGE2 on muscle contraction.
The effects of PGE2 on the time and tension parameters of the isometric twitch were investigated in vitro in both murine soleus and EDL. No effects on active tension and on time to peak tension were detected at concentrations up to 10 µM. However, PGE2 induced a small but significant reduction in the half-relaxation time that was evident in the slow muscle type, i.e., the soleus, rather than in the EDL (Fig. 7).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 7. Effects of different concentrations of PGE2 on contraction and relaxations of mouse soleus and EDL muscles. A–C: histograms of means ± SE (n = 3) of active tension (A), time to peak tension (B), and time to half relaxation (C) in the presence of 100 nM (open bars), 1 µM (crosshatched bars), and 10 µM (filled bars) of PGE2 (see MATERIALS AND METHODS for technical details). Values express % of vehicle-treated samples. *P < 0.01 vs. vehicle. D and E: effect of 10 µM PGE2 on the twitch of soleus (D) and EDL (E). The solid lines indicate contraction in control condition, and the dashed lines indicate contraction in the presence of 10 µM PGE2.
|
|
COX expression and activity in the myocardium.
Myocardial samples from mouse and rat expressed mRNA and protein of both COX-1 and -2, as shown by RT-PCR (Fig. 1) and Western blot. By immunohistochemistry, COX-1 and COX-2 proteins showed a diffuse pattern of expression in cardiomyocytes of human, mouse, and rat hearts (Fig. 8).

View larger version (184K):
[in this window]
[in a new window]
|
Fig. 8. Immunoperoxidase staining of myocardium samples from human (A and B), mouse (C and D), and rat (E and F) samples. A, C, and E were reacted with anti COX-1 antibodies; B, D, and F were reacted with anti-COX-2 antibodies and developed with peroxidase. Original magnification = x20. Inset in A: original magnification = x40. *Vessels whose smooth muscle cells within the tunica media do not react with anti-COX-1 or -2 antibodies.
|
|
Mouse and rat myocardial samples, loaded with 20 µM AA, released 28 ± 13 and 32.6 ± 14.12 pg/mg of tissue of PGE2, respectively (n = 6 for each species), in 30-min incubation. Thus similar amounts of PGE2 were released from fragments of mouse and rat myocardium.
In rat samples, SC-560 (100 nM) lowered the amount of PGE2 released in 30 min to 6.4 ± 3.4 pg/mg of tissue, corresponding to an 80% inhibition (P < 0.05), whereas NS-398 (100 nM) reduced the production to 12.2 ± 4.4 pg/mg of tissue, corresponding to a 63% inhibition (P < 0.05). In mouse samples, SC-560 significantly inhibited PGE2 release by 59% on average, whereas NS-398 caused an average 80% inhibition. These data, showing that each selective COX inhibitor caused an incomplete inhibition of PGE2 production from heart muscle, indicate that both isoforms are enzymatically active and contribute to PGE2 generation in the myocardium.
 |
DISCUSSION
|
|---|
The present study demonstrates a constitutive expression of both COX-1 and COX-2 in different types of muscles fibers and in cardiomyocytes of three different species. At least in rodents, COX isozymes are enzymatically active, being inhibited by COX-1 or -2 selective blockers. Furthermore, in the murine soleus, which is a slow type muscle, PGE2 in the low micromolar range made relaxation significantly faster.
Whereas COX expression or PG generation has been previously described during myogenesis and skeletal muscle regeneration, more limited information is available on the role of PGs in adult skeletal muscle physiology and on the expression in skeletal muscle fibers of the enzymes responsible for PG production. More than 20 years ago, Rodemann and coworkers (22, 23) suggested a role for exogenous PGE2 and PGF2
in the acceleration of muscle protein turnover, well before the discovery of COX-2. A generic role for COX-derived compounds on protein metabolism in skeletal muscle has also been hypothesized by some authors to explain the analgesic effect of ibuprofen and acetaminophen after eccentric exercise in humans without characterizing the expression and the type of COX isoenzymes involved (31, 32). A role for PGs in muscle cell fusion and growth in different animal species has also been reported (4, 6, 14, 17, 24, 29, 33, 38). More recently, it has been reported that COX-2 is required during mouse skeletal muscle regeneration after different models of injury, using selective COX-2 inhibitors and/or COX-2-deleted mice (1, 5, 27), although none of those studies assessed the type of PG involved. Data indicating a role for the AA cascade in regeneration is possibly consistent with our data, showing only minor modulation on contractile properties, which might indirectly indicate a role for PGs in muscle housekeeping functions, such as muscle trophism or repair. Consistently, a possible involvement of PGs in degenerative muscle diseases is suggested by the observation of an increased production in muscles of patients with Duchenne muscular dystrophy or of mdx mice (9, 13). PGE2 is known to cause relaxation via the EP2 receptors in vascular (37) and airway smooth muscles (7, 26, 30). Arterial infusion of PGE2 leads to a marked increase in blood flow in the human forearm as well as in canine skeletal muscle arteries. Divergent findings on the role of prostanoids in exercise hyperemia have been reported (3). Altogether, these observations might imply a role of PGE2 in the regulation of muscle microcirculation.
No data are available on a possible role of PGE2 on skeletal muscle contraction. Our data show a modest reduction of half-relaxation time induced by PGE2 in the low micromolar range in the slow soleus muscle, whereas no effect was observed in the fast EDL muscle. This diversity could be explained by the difference among the slow and fast muscle fibers in controlling cytosolic calcium. Slow muscle fibers share with cardiac and smooth muscle, although to a limited extent, the regulation of sarcoplasmic reticulum calcium pump via phospholamban (34) and the involvement of transarcolemmal calcium movements in the transient increase, which accompanies contraction (8, 19). Further study will clarify the physiological relevance.
Our data showed that cardiomyocytes also express enzymatically active COX-1 and -2 in different species, extending previous reports from different groups. Using cultures of rat neonatal ventricular myocytes, Mendez and Lapointe (15, 16) demonstrated an induction of COX-2 in vitro, but they did not find expression in cultured resting cells. At variance with these observations, we found a constitutive presence of COX-2 in cardiomyocytes of young adult rats and mice at both RNA and protein levels. A possible explanation is that in vitro conditions might downregulate COX-2 gene expression or that neonatal myocytes have a different COX-2 expression compared with fully differentiated adult cells. It would be interesting to explore which is the trigger in the heart for a physiological constitutive COX-2 expression in cardiomyocytes. The report of a constitutive expression of COX-2 in human cardiomyocytes is quite novel. Although we recognize that our observations are on postmortem tissues, since the collection of fresh and healthy myocardium is unethical, the consistency of a constitutive expression of COX-2 among three different species indirectly supports the likelihood of our finding in living human hearts as well. Wong et al. (36) described a strong expression of COX-2 in failing human hearts but found no expression in control hearts. This discrepancy might be due to different sources of antibodies used in Wong et al.'s and our experiments. On the contrary, our data are in agreement with Liu and coworkers (11), who found a constitutive expression of both COX-1 and -2 in rat hearts, and this expression was enhanced by lipopolysaccharide infused in vivo. We report that PGE2 was the main PG released by rodent hearts via COX-1 and COX-2. The prevalence of PGE2 is consistent with data reported in vitro in cultured neonatal rat cardiomyocytes (16).
In conclusion, the present study demonstrates that COX isozymes are both expressed and enzymatically active in striated muscles, both in myocardial and skeletal muscles. The predominant PG produced is PGE2. Our data also suggest a modulation of slow skeletal muscle relaxation by PGE2.
 |
GRANTS
|
|---|
This study was supported in part by the European Commission FP6 grant (LSHM-CT-2004-0050333). This publication reflects only the author's views. The Commission is not liable for any use that may be made of information herein.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: M. Testa, Dept. of Cardiology, Azienda Ospedaliera Sant'Andrea, Via di Grottarossa 1035, 00189 Roma, Italy (e-mail: mar.testa{at}tin.it)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Bondesen BA, Mills ST, Kegley KM, Pavlath GK. The COX-2 pathway is essential during early stages of skeletal muscle regeneration. Am J Physiol Cell Physiol 287: C465–C483, 2004.
- Ciabattoni G, Pugliese F, Spaldi M, Cinotti GA, Patrono C. Radioimmunoassay measurement of prostaglandins E2 and F2alpha in human urine. J Endocrinol Invest 2: 173–182, 1979.[Web of Science][Medline]
- Clifford PS, Hellsten Y. Vasodilatory mechanisms in contracting skeletal muscle. J Appl Physiol 97: 393–403, 2004.[Abstract/Free Full Text]
- David JD, Higginbotham CA. Fusion of chick embryo skeletal myoblasts: interactions of prostaglandin E1, adenosine 3':5' monophosphate, and calcium influx. Dev Biol 82: 308–316, 1981.[CrossRef][Web of Science][Medline]
- Dupouy VM, Ferre PJ, Uro-Coste E, Lefebvre HP. Time course of COX-1 and COX-2 expression during ischemia-reperfusion in rat skeletal muscle. J Appl Physiol 100: 233–239, 2006.[Abstract/Free Full Text]
- Entwistle A, Curtis DH, Zalin RJ. Myoblast fusion is regulated by a prostanoid of the one series independently of a rise in cyclic AMP. J Cell Biol 103: 857–866, 1986.[Abstract/Free Full Text]
- Fortner CN, Breyer RM, Paul RJ. EP2 receptors mediate airway relaxation to substance P, ATP, and PGE2. Am J Physiol Lung Cell Mol Physiol 281: L469–L674, 2001.[Abstract/Free Full Text]
- Froemming GR, Murray BE, Harmon S, Pette D, Ohlendieck K. Comparative analysis of the isoform expression pattern of Ca2+-regulatory membrane proteins in fasttwitch, slow-twitch, cardiac, neonatal, and chronic low-frequency stimulated muscle fibers. Biochim Biophys Acta 1466: 151–168, 2000.[Medline]
- Jackson MJ, Brooke MH, Kaiser K, Edwards RH. Creatine kinase and prostaglandin E2 release from isolated Duchenne muscle. Neurology 41: 101–104, 1991.[Abstract/Free Full Text]
- Karamouzis M, Langberg H, Skovgaard D, Bulow J, KjaerM, Saltin B. In situ microdialysis of intramuscular prostaglandin and thromboxane in contracting skeletal muscle in humans. Acta Physiol Scand 171: 71–76, 2001.[CrossRef][Web of Science][Medline]
- Liu SF, Newton R, Evans TW, Barnes PJ. Differential regulation of cyclo-oxygenase-1 and cyclo-oxygenase-2 gene expression by lipopolysaccharide treatment in vivo in the rat. Clin Sci (Lond) 90: 301–306, 1996.[Medline]
- McArdle A, Edwards RH, Jackson MJ. Release of creatine kinase and prostaglandin E2 from regenerating skeletal muscle fibers. J Appl Physiol 76: 1274–1278, 1994.[Abstract/Free Full Text]
- McArdle A, Edwards RHT, Jackson MJ. Effects of contractile activity on muscle damage in the dystrophin-deficient mdx mouse. Clin Sci (Lond) 80: 367–371, 1991.[Medline]
- McLennan IS. Hormonal regulation of myoblast proliferation and myotube production in vivo: influence of prostaglandins. J Exp Zool 241: 237–245, 1987.[CrossRef][Web of Science][Medline]
- Mendez M, LaPointe MC. PGE2-induced hypertrophy of cardiac myocytes involves EP4 receptor-dependent activation of p42/44 MAPK and EGFR transactivation. Am J Physiol Heart Circ Physiol 288: H2111–H2117, 2005.[Abstract/Free Full Text]
- Mendez M, LaPointe MC. Trophic effects of the cyclooxygenase-2 product prostaglandin E2 in cardiac myocytes. Hypertension 39: 382–388, 2002.[Abstract/Free Full Text]
- Otis JS, Burkholder TJ, Pavlath GK. Stretch-induced myoblast proliferation is dependent on the COX2 pathway. Exp Cell Res 310: 417–425, 2005.[CrossRef][Web of Science][Medline]
- Parkington HC, Tonta MA, Davies NK, Brennecke SP, Coleman HA. Hyperpolarization and slowing of the rate of contraction in human uterus in pregnancy by prostaglandins E2 and f2alpha: involvement of the Na+ pump. J Physiol 514: 229–243, 1999.[Abstract/Free Full Text]
- Pereon Y, Dettbarn C, Lu Y, Westlund KN, Zhang JT, Palade P. Dihydropyridine receptor isoform expression in adult rat skeletal muscle. Pflügers Arch 436: 309–314, 1998.[CrossRef][Web of Science][Medline]
- Rocca B, Spain LM, Ciabattoni G, Patrono C, FitzGerald GA. Differential expression and regulation of cyclooxygenase isozymes in thymic stromal cells. J Immunol 162: 4589–4597, 1999.[Abstract/Free Full Text]
- Rocca B, Patrono C. Determinants of the interindividual variability in response to antiplatelet drugs. J Thromb Haemost 3: 1597–1602, 2005.[CrossRef][Web of Science][Medline]
- Rodeman HP, Goldberg AL. Arachidonic acid, PGE2 and F2
influence rates of protein turnover in skeletal and cardiac muscle. J Biol Chem 257: 1632–1638, 1982.[Free Full Text] - Rodeman HP, Waxamn L, Goldberg AL. The stimulation of protein degradation in muscle by Ca2+ is mediated by prostaglandin E2 and does not require the calcium-activated protease. J Biol Chem 257: 8716–8723, 1982.[Abstract/Free Full Text]
- Rossi MJ, Clark MA, Steiner SM. Possible role of prostaglandins in the regulation of mouse myoblasts. J Cell Physiol 141: 142–147, 1989.[CrossRef][Web of Science][Medline]
- Schiaffino S, Gorza L, Sartore S, Saggin L, Ausoni S, Vianello M, Gundersen K, Lomo T. Three myosin heavy chain isoforms in type 2 skeletal muscle fibres. J Muscle Res Cell Motil 10: 197–205, 1989.[CrossRef][Web of Science][Medline]
- Sheller JR, Mitchell D, Meyrick B, Oates J, Breyer R. EP2 receptor mediates bronchodilation by PGE2 in mice. J Appl Physiol 88: 2214–2218, 2000.[Abstract/Free Full Text]
- Shen W, Li Y, Tang Y, Cummins J, Huard J. NS-398, a cyclooxygenase-2-specific inhibitor, delays skeletal muscle healing by decreasing regeneration and promoting fibrosis. Am J Pathol 167: 1105–1117, 2005.[Abstract/Free Full Text]
- Simmons DL, Botting RM, Hla T. Cyclooxygenase isozymes: the biology of prostaglandin synthesis and inhibition. Pharmacol Rev 56: 387–437, 2004.[Abstract/Free Full Text]
- Templeton GH, Padalino M, Moss R. Influences of inactivity and indomethacin on soleus phosphatidylethanolamine and size. Prostaglandins 31: 545–559, 1986.[CrossRef][Web of Science][Medline]
- Tilley SL, Hartney JM, Erikson CJ, Jania C, Nguyen M, Stock J, McNeisch J, Valancius C, Panettieri RA Jr, Penn RB, Koller BH. Receptors and pathways mediating the effects of prostaglandin E2 on airway tone. Am J Physiol Lung Cell Mol Physiol 284: L599–L606, 2003.[Abstract/Free Full Text]
- Trappe TA, Fluckey JD, White F, Lambert CP, Evans WJ. Skeletal muscle PGF2
and PGE2 in response to eccentric resistance exercise: influence of ibuprofen and acetaminophen. J Clin Endocrinol Metab 86: 5067–5070, 2001.[Abstract/Free Full Text] - Trappe TA, White F, Lambert CP, Cesar D, Hellerstein M, Evans WJ. Effect of ibuprofen and acetaminophen on postexercise muscle protein synthesis. Am J Physiol Endocrinol Metab 282: E551–E556, 2002.[Abstract/Free Full Text]
- Vandenburgh HH, Hatfaludy S, Sohar I, Shansky J. Stretch-induced prostaglandins and protein turnover in cultured skeletal muscle. Am J Physiol Cell Physiol 259: C232–C240, 1990.[Abstract/Free Full Text]
- Vangheluwe P, Schuermans M, Zador E, Waelkens E, Raeymaekers L, Wuytack F. Sarcolipin and phospholamban mRNA and protein expression in cardiac and skeletal muscle of different species. Biochem J 389: 151–159, 2005.[CrossRef][Web of Science][Medline]
- Young EW, Sparks HV. Prostaglandin E release from dog skeletal muscles during restricted flow exercise. Am J Physiol Heart Circ Physiol 236: H596–H599, 1979.[Abstract/Free Full Text]
- Wong SC, Fukuchi M, Melnyk P, Rodger I, Giaid A. Induction of cyclooxygenase-2 and activation of nuclear factor-kappaB in myocardium of patients with congestive heart failure. Circulation 98: 100–103, 1998.[Abstract/Free Full Text]
- Zhang Y, Guan Y, Schneider A, Brandon S, Breyer RM, Breyer MD. Characterization of murine vasopressor and vasodepressor prostaglandin E(2)receptors. Hypertension 35: 1129–1134, 2000.[Abstract/Free Full Text]
- Zalin RJ. Prostaglandins and myoblast fusion. Dev Biol 59: 241–248, 1977.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
A. Kadotani, Y. Tsuchiya, H. Hatakeyama, H. Katagiri, and M. Kanzaki
Different impacts of saturated and unsaturated free fatty acids on COX-2 expression in C2C12 myotubes
Am J Physiol Endocrinol Metab,
December 1, 2009;
297(6):
E1291 - E1303.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Yoshikawa, M. Nagasaki, M. Sano, S. Tokudome, K. Ueno, N. Shimizu, S. Imoto, S. Miyano, M. Suematsu, K. Fukuda, et al.
Ligand-based gene expression profiling reveals novel roles of glucocorticoid receptor in cardiac metabolism
Am J Physiol Endocrinol Metab,
June 1, 2009;
296(6):
E1363 - E1373.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Jenkins, A. Cedars, and R. W. Gross
Eicosanoid signalling pathways in the heart
Cardiovasc Res,
May 1, 2009;
82(2):
240 - 249.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Oliver, V. P. Wright, N. Parinandi, and T. L. Clanton
Thermal tolerance of contractile function in oxidative skeletal muscle: no protection by antioxidants and reduced tolerance with eicosanoid enzyme inhibition
Am J Physiol Regulatory Integrative Comp Physiol,
November 1, 2008;
295(5):
R1695 - R1705.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2007 by the American Physiological Society.