Journal of Applied Physiology Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

J Appl Physiol 102: 1078-1089, 2007. First published November 16, 2006; doi:10.1152/japplphysiol.00791.2006
8750-7587/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
102/3/1078    most recent
00791.2006v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chow, L. S.
Right arrow Articles by Nair, K. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chow, L. S.
Right arrow Articles by Nair, K. S.

Impact of endurance training on murine spontaneous activity, muscle mitochondrial DNA abundance, gene transcripts, and function

Lisa S. Chow, Laura J. Greenlund, Yan W. Asmann, Kevin R. Short, Shelly K. McCrady, James A. Levine, and K. Sreekumaran Nair

Division of Endocrinology, Nutrition and Metabolism, Mayo Clinic College of Medicine, Rochester, Minnesota

Submitted 17 July 2006 ; accepted in final form 9 November 2006


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
We hypothesized that enhanced skeletal muscle mitochondrial function following aerobic exercise training is related to an increase in mitochondrial transcription factors, DNA abundance [mitochondrial DNA (mtDNA)], and mitochondria-related gene transcript levels, as well as spontaneous physical activity (SPA) levels. We report the effects of daily treadmill training on 12-wk-old FVB mice for 5 days/wk over 8 wk at 80% peak O2 consumption and studied the training effect on changes in body composition, glucose tolerance, muscle mtDNA muscle, mitochondria-related gene transcripts, in vitro muscle mitochondrial ATP production capacity (MATPC), and SPA levels. Compared with the untrained mice, the trained mice had higher peak O2 consumption (+18%; P < 0.001), lower percentage of abdominal (–25.4%; P < 0.02) and body fat (–19.5%; P < 0.01), improved glucose tolerance (P < 0.04), and higher muscle mitochondrial enzyme activity (+19.5–43.8%; P < 0.04) and MATPC (+28.9 to +32.4%; P < 0.01). Gene array analysis showed significant differences in mRNAs of mitochondria-related ontology groups between the trained and untrained mice. Training also increased muscle mtDNA (+88.4 to +110%; P < 0.05), peroxisome proliferative-activated receptor-{gamma} coactivator-1{alpha} protein (+99.5%; P < 0.04), and mitochondrial transcription factor A mRNA levels (+21.7%; P < 0.004) levels. SPA levels were higher in trained mice (P = 0.056, two-sided t-test) and significantly correlated with two separate substrate-based measurements of MATPC (P < 0.02). In conclusion, aerobic exercise training enhances muscle mitochondrial transcription factors, mtDNA abundance, mitochondria-related gene transcript levels, and mitochondrial function, and this enhancement in mitochondrial function occurs in association with increased SPA.

mouse; endurance exercise; mitochondria adenosine 5'-triphosphate production; gene array; physical activity

AGE-ASSOCIATED ACCUMULATION of mitochondrial DNA (mtDNA) damage and decreased mtDNA abundance may contribute to age-associated muscle dysfunction and insulin resistance (34, 49). As skeletal muscle is a major site of glucose utilization, correlational data support the hypothesis that insulin resistance is related to age-associated reductions in muscle mitochondrial function (39, 51). Age is also associated with progressive decline in physical activity levels in a wide range of species, ranging from the Caenorhabditis elegans worm (16) to humans (5), with major metabolic consequences. Previously, we have hypothesized that age-related decrease in spontaneous physical activity (SPA) is related to decline in skeletal muscle mitochondrial ATP production (36). In addition, reduced levels of SPA, described as physical activity separate from voluntary exercise, has contributed to the obesity epidemic in the population (25). It remains unknown whether aerobic exercise training enhances SPA levels.

Aerobic exercise partially reverses the typical age-associated decline in muscle function. Six-week-old rats subjected to a 12-wk treadmill exercise training program have shown increased skeletal muscle mitochondrial oxidative capacity (18). Subsequently, treadmill-based studies have characterized the effects of chronic aerobic exercise on skeletal muscle physiology. In rats (age 17.5 wk), treadmill training at 75% maximal O2 uptake for 10 wk (30–90 min/day, 5 days/wk) augmented citrate synthase (CS) activity and shifted the myosin heavy chain (MHC) fiber type to a more oxidative phenotype (8). The effects of treadmill training duration (30–90 min) and intensity (10–60 m/min) on rat (6 wk old, trained 5 days/wk for 8 wk) muscle cytochrome-c quantity may vary, depending on the underlying muscle fiber composition (10). In adult humans, a 4-mo aerobic exercise program (cycling program, 4 days/wk, 40 min/session, training speed elicited 80% of maximal heart rate) improved insulin sensitivity, mitochondrial enzyme activity (49), and mixed muscle protein synthesis (48). Despite similar enhancement of muscle mitochondrial function in response to aerobic exercise training, younger people increased insulin sensitivity more than older people, indicating dissociation between increases in insulin sensitivity and mitochondrial function.

Aerobic exercise has been reported to enhance muscle mitochondrial biogenesis through a calcium-regulated signaling pathway (57). Chronic aerobic exercise has also been shown to stimulate 5'-AMP-activated protein kinase (AMPK) activity with subsequent increases in fatty acid oxidation and glucose uptake in skeletal muscle (11, 13). There is also evidence that chronic chemical activation of AMPK increases mitochondrial enzyme activity in selected skeletal muscle, suggesting a possible role of AMPK in mitochondrial biogenesis (56). The exact mechanism behind the effects of exercise on increasing mitochondrial function, however, remains incompletely defined.

Endurance treadmill exercise studies have been less commonly performed in mice (21), with interstrain variation observed in exercise capacity (3, 28) and training response (30). Recently, the response to exercise training in three inbred mouse strains (C57Bl/6J, FVB/NJ, Balb/cJ) was studied by exercising 8-wk-old mice (5 days/wk, 60 min/day, 60% of maximal work load, ~15–19 m/min at 5–10° incline) for 4 wk. Variable increases in running distance (23–172%), run time (11–87%), and work (57–287%) were observed, with the FVB strain having the greatest response to training (distance +172%, run time +87%, work +287%) (30).

As transgene placement and other genetic manipulations are frequently conducted in mice, we used a mouse model (FVB strain) of aerobic exercise training to determine the underlying mechanism of aerobic exercise-related changes in muscle. We measured the effects of aerobic exercise on physiological and skeletal muscle cellular (gene array, mRNA, Western blot) changes to explain the observed improvement in muscle mitochondrial function. We hypothesized that enhanced muscle mitochondrial function following aerobic exercise training is related to an increase in mitochondrial transcription factors, DNA abundance (mtDNA), and mitochondria-related gene transcript levels, as well as SPA levels.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
Animals.   Male wild-type (WT) FVB mice were housed in cages with a 12:12-h light-dark photocycle (lights on at 6:00 AM) in a room at 22 ± 2°C. Food (Laboratory Rodents Diet 5001; PMI Nutrition International, St. Louis, MO) and water were allowed ad libitum. The protocol was approved by the Mayo Foundation Institutional Animal Care and Use Committee.

At 8 wk of age, the mice were acclimatized to the treadmill with daily 15-min sessions (9 m/min at 0° incline for 3 days, then 5 m/min at 15° incline 2 days) for 1 wk. The mice then underwent baseline studies: oral glucose tolerance test (OGTT), peak O2 consumption (VO2 peak) testing, resting energy expenditure (REE), basal activity level, and body composition by dual X-ray absorption (DXA). After these baseline studies and treadmill acclimatization were completed, the mice started their treadmill exercise program at ages 10–12 wk.

OGTT.   Mice were fasted overnight for 12 h and then received glucose (2 g/kg glucose) by oral gavage. Blood was collected by tail vein sampling at 0, 15, 30, 45, 60, 90, and 120 min after glucose administration and measured by the glucose oxidase method (One Touch, Life Scan, Milpitas, CA). Insulin was measured at the conclusion of the OGTT (120 min) using blood from a terminal cardiac puncture. The blood was collected and placed in tubes with EDTA. Insulin levels were measured using radioimmunoassay (Linco, St. Charles, MO; catalog no. EZRMI-13K).

VO2 peak.   To measure VO2 peak, we used a single-lane sealed treadmill (Columbus Instruments, Columbus, OH), which continuously measured O2 and CO2 consumption. After an initial 10-min warm-up session, the mice ran on the treadmill at a speed of 10 m/min at a 25% incline. Every 2 min, the treadmill speed was increased by 2 m/min. Each mouse ran until exhaustion. The VO2 peak was defined as O2 consumption at maximum exercise per kilogram of fat-free mass (FFM) (21).

REE.   Oxygen consumption and CO2 production were measured using a customized, high-precision, single-chamber indirect calorimeter (Columbus Instruments), as previously reported (23, 26). The REE was performed in the untrained WT group at an average of 20.18 wk (mean 20.18 wk, SD 0.34, SE 0.12) and in the trained WT group at an average age of 20.43 wk (mean 20.43 wk, SD 0.51, SE 0.18) with a two-sided t-test showing a P value of 0.29 between the two groups. Each mouse was acclimatized to a metabolic chamber for 2 days with access to food and water ad libitum. This was performed to minimize the effects of acute exercise and to familiarize the mice to the metabolic chamber environment. Thermogenesis was calculated from O2 consumption and CO2 production. Calibration of the calorimeter was performed before each measurement using primary standard gases. The animal was placed inside a cylindrical calorimeter chamber (acrylic; diameter 30 cm, height 20 cm, volume 15 liters) along with the food and water bowls. The chamber lid was sealed, and room air was pumped at atmospheric pressure through the chamber at 0.802 l/min. Data on O2 consumption and CO2 production were then collected every minute for 24 h and stored on a personal computer, with each data point identified by a time stamp.

SPA.   SPA was measured simultaneously with measurement of the O2 consumption and CO2 production. The aforementioned metabolic chamber was also equipped with infrared photocell sensors (Opto-Varimex, Columbus Instruments). Measurements were performed using customized, high-precision racks of collimated infrared activity sensors (Columbus Instruments) placed around the acrylic chamber. There were 45 collimated beams of infrared light crossing the 30-cm-diameter cage, allowing the detection of 1 cm of movement in three orthogonal axes. Photosensors registered an activity unit each time a beam was interrupted. In this fashion, physical activity was detected simultaneously on all three axes: forward and backward, side to side, up and down. Data for SPA were summed for every minute and stored on the personal computer with use of the time stamp for identification. Data were thereby derived simultaneously for O2 consumption and SPA, for each animal, minute by minute, over the 24-h measurement period. SPA was reported as beam breaks over 19 h of measurement to maintain a consistent observational time period for each animal. An 8-mm charge-coupled device video camera with infrared and digital time recording capabilities was used for the measuring of feeding behavior. The experiments were also videotaped with time-stamp for reference. Movement episodes were defined as a session of continuous activity with absent activity preceding or following the session.

DXA measurement.   The mice were scanned before and after the 2-mo exercise training period by DXA using the PIXIMUS scanner (Lunar, Madison, WI). A combination of xylazine (7.5 mg/kg) and ketamine (90 mg/kg) was used for sedation. The animals were scanned in a prone position with extended extremities. Fat mass and lean body mass were measured in the abdomen (top of the pelvis to the lowermost rib) and total body (excluding head). The percentage of abdominal fat was calculated as abdominal fat content divided by total abdomen tissue content. The percentage of total body fat was calculated as total body fat content divided by total body tissue content.

Exercise program.   We used an 8-wk treadmill exercise protocol shown to increase VO2 peak by 30–50% in mice (21). Treadmill exercise training started at age 10–12 wk. The training speed (~80% of VO2 peak) was selected by running the mice to exhaustion using a protocol of a 10-min warm-up period, then raising the treadmill to a 25° incline and setting the treadmill speed at 8 m/min. The treadmill speed was increased by 2 m/min every 10 min until the mouse refused to run any further, thus designating the maximal running speed for the mouse. Using this information, we placed the mouse in single-chamber sealed modular treadmill (Columbus Instruments) and selected a training speed at which oxygen consumption is 80–90% of VO2 peak. After selecting the training speed, we trained the mice on a mouse-sized treadmill (1055M Exer-6M Open Treadmill for Mice with Shocker, Columbus Instruments) initially for 45 min each day and then progressively increased the training duration toward a goal of 2 h/day. For each daily session, the mice underwent interval training (8 min at training speed, 2 min "rest" at 5 m/min). The mice were continually monitored during their training sessions. Electric shocks, air puffs, or manual prodding were used as needed to maintain the running speed. If a mouse refused to run despite stimulation, they were removed from the training session for the day. If the mouse continued to refuse to run at a certain treadmill speed, they were inspected for injury and were either trained at a lower treadmill speed or removed from the training program. The training speed was adjusted every 2 wk to accommodate improvement in endurance. Concurrently, matched untrained mice maintained familiarity with the treadmill (9 m/min, 0° incline, 15-min duration, three times/wk) (21).

Tissue collection.   The untrained mice were killed at least 1 wk after their most strenuous exercise exposure (measurement of VO2 peak). The trained mice were killed at least 24 h after their last training session. Before death, the mice were fasted overnight and underwent an OGTT as described above. At the conclusion of the OGTT (120 min), the mice were euthanatized using pentobarbital (100 mg/kg intraperitoneal injection), underwent a terminal cardiac puncture, and had the skeletal muscles, heart, and liver immediately collected. Due to its involvement in the running process, the quadriceps muscle was used for the skeletal muscle measurements. One quadriceps muscle was sent fresh for immediate processing of ATP synthesis, and the contralateral quadriceps muscle was snap frozen in liquid nitrogen for future measurements.

mRNA quantitation.   A real-time quantitative polymerase chain reaction system (Applied Biosystems, Foster City, CA) was used to measure the abundance of mtDNA and mRNA in muscle tissue (1). DNA was extracted from frozen skeletal muscle by using a QIAamp DNA mini kit (Qiagen, Valencia, CA), and total RNA was isolated using the RNeasy fibrous tissue mini kit (Qiagen). The RNA was reverse transcribed using the TaqMan Reverse Transcription Reagents (Applied Biosystems, Foster City, CA), according to the manufacturer's instruction. The primer and probe sequences used for the mtDNA were as follows: NADH 1 (Genbank accession no. NC_005089) forward primer, AAGGAGAATCAGAATTAGTATCAGGGTT, and reverse primer, TAGTACTCTGCTATAAAGAATAACGCGAAT, and probe, 6FAM-ACGTAGAATACGCAGCCGGCC; NADH 4 (Genbank accession no. NC_005089) forward primer, TCCAACTACGAACGGATCCA, reverse primer, AAGTGGGAAGACCATTTGAAGTC, and probe, 6FAM-AGCCGTACTATAATCATGGCCCGA. Primers and probes to determine the abundance of mRNA for mitochondrial transcription factor A (TFAM) and peroxisome proliferative-activated receptor-{gamma} coactivator (PGC)-1{alpha} were designed to expand exon boundaries and were as follows: TFAM (Genbank accession no. NM_009360) forward primer, GGTCGCATCCCCTCGTCTA, TFAM reverse primer, CTCATAGGTTTCTTTGGATAGCTACCC, TFAM probe, 6FAM-CAGTCTTGTCTGTATTCCGAAGTGTTTTTCC; PGC-1{alpha} (Genbank accession no. NM_008904) forward primer, ACCCACAGGATCAGAACAAACC, PGC-1{alpha} reverse primer, CAAATGCTCTTCGCTTTATTGCT, and PGC-1{alpha} probe, 6FAM-CATGAATTCTCGGTCTTAACAATGGCA. The mtDNA and RNA samples were run in duplicate and normalized to 28S ribosomal RNA. The primer and probe sets for the 28S rRNA were as follows: forward primer, TGGGAATGCAGCCCAAAG, reverse primer, CCTTACGGTACTTGTTGGCTATCG, and probe, VIC-TGGTAAACTCCATCTAAGGCTAAATACCGGCA.

In vitro measurement of mitochondrial ATP production.   Fresh muscle tissue (50 mg) was minced on a chilled glass plate and washed in buffer A (100 mM KCl, 50 mM Tris base, 5 mM MgCl2, 1.8 mM ATP, 1 mM EDTA, pH 7.2). The tissue was transferred to a glass mortar and homogenized in 20 volumes of buffer A with a motor-driven Teflon pestle. Samples were centrifuged at 1,020 g for 10 min at 4°C, and the supernatant was removed and respun at the same speed. The supernatant was centrifuged at 10,000 g for 5 min at 4°C. The resulting pellet was resuspended in buffer A and respun at 9,000 g for 5 min at 4°C. This final mitochondrial pellet was suspended in buffer containing 180 mM sucrose, 35 mM KH2PO4, 10 mM Mg acetate, and 5 mM EDTA and used to measure mitochondrial ATP production with a bioluminescent technique, as previously described (46, 47, 54). The reaction mixture included a luciferin-luciferase ATP monitoring reagent (BioThema, Haninge, Sweden), substrates for oxidation, and 35 µM ADP. Substrates used were (in mM final concentration): 10 glutamate plus 1 malate (GM), 20 succinate plus 0.1 rotenone (SR), 1 pyruvate plus 0.05 palmitoyl-L-carnitine plus 10 {alpha}-ketoglutarate plus 1 malate, 1 pyruvate plus 1 malate, 0.05 palmitoyl-L-carnitine plus 1 malate (PCM), and 10 {alpha}-ketoglutarate with blank tubes used for measuring background activity. All reactions for a given sample were monitored simultaneously at 25°C for 20–25 min and calibrated with addition of an ATP standard using a BioOrbit 1251 luminometer (BioOrbit Oy, Turku, Finland). Frozen tissue samples from the same biopsies were used to determine the whole tissue activity of CS (43) and cytochrome-c oxidase (COX) (Sigma Chemical, St. Louis, MO). Activity of CS in mitochondria and tissue homogenates was used to calculate ATP production in the whole tissue, as previously described (47, 54).

Mitochondrial enzyme activity.   Aliquots of muscle homogenate were used to measure protein concentration (DC protein assay, Bio-Rad Laboratories, Hercules, CA) and the activity of the mitochondrial enzymes CS (from the Krebs cycle), COX (part of the respiratory chain), and L-3-hydroxyacyl coenzyme A dehydrogenase (BHAD; a step in fatty acid beta-oxidation) using spectrophotometric assays, as previously described (44, 47).

Western blot.   For Western blotting of PGC-1{alpha}, AMPK, and phosphorylated AMPK (AMPK-P), the quadriceps muscle was homogenized (1:20) in cell lysis buffer (no. 9803, Cell Signalling Technology, Danvers, MA) mixed with protease inhibitor (Roche 1836153-Protease Inhibitor Cocktail, Indianapolis, IN). For measurement of MHC I, we homogenized the muscle in ice-cold buffer (1:40) containing 177 mM potassium chloride, 10 mM Tris·HCl, and 2 mM EDTA (pH 7.2). The samples were boiled for 5 min.

For cellular proteins, the samples were centrifuged at 10,000 g for 10 min, and the supernatant was saved for Western analysis and protein determination (Bio-Rad DC Protein Assay kit). The supernatant was mixed (3:1 vol/vol) with 4x sample buffer (Invitrogen NP 0007 Nu Page LDS sample buffer, Carlsbad, CA) and diluted with 1x sample buffer as needed to equalize protein concentrations across samples; 2-mercaptoethanol (Bio-Rad, no. 161–0710) was added (1:20). The samples were then placed in a thermal mixer at 70°C for 15 min and separated using NuPAGE 4–12% Tris-Bis (Invitrogen, NP0329BOX) and transferred to polyvinylidene difluoride (Bio-Rad 162–0177) membrane. Hybridization was performed with anti-PGC-1{alpha} COOH-terminal antibodies (CalBiochem, San Diego, CA) (1:500) and total AMPK-{alpha} and phosphorylated AMPK-{alpha} (Thr 172) antibodies (1:1,000) (Cell Signalling) and incubated with secondary antibodies/5% nonfat dry milk (1:3,000) at room temperature for 2–3 h. Chemiluminescent substrate (enhanced chemiluminescence, ECL-Plus; Amersham, Piscataway, NJ) was used for detection. Scanning and densitometry were done using the Kodak Image Station 1000.

For MHC1, the samples were diluted using Laemmli sample buffer (2:1) (Bio-Rad) and run on NuPAGE 4–12% Tris-Bis gel (Invitrogen; NP0329BOX). The samples were run at 100 V for 45 min and transferred to a Bio-Rad Immun-Blot polyvinylidene difluoride (Bio-Rad 162–0177) membrane at 19 V for 45 min. MyoHC1 (1:1,000)-clone NOQ7.5.4D (Sigma) was added as the primary antibody. The antimouse antibody (1:5,000) was diluted in TBS and exposed to the membrane for 2–3 h, and chemiluminescent substrate (enhanced chemiluminescence, ECL-Plus; Amersham) was used for detection.

Microarray analysis.   For the microarray analysis, total RNAs were purified using RNeasy Protect Mini Kit (QIAGEN, Valencia, CA) from quadriceps muscle of trained mice (n = 5) and untrained mice (n = 5). The quality and quantity of the total RNAs were measured using Agilent Bioanalyzer (Agilent Technologies, Palo Alto, CA). All samples possessed 18S and 28S rRNA peaks with no evidence of RNA degradation. Total RNAs from each mouse were hybridized onto individual mouse 430A 2.0 GeneChip (Affymetrix, Santa Clara CA). Sample labeling, hybridization of test array, and hybridization of full size arrays were performed using standard protocols (Affymetrix). We subjected the microarray data to invariant probe set normalization with perfect match-only model by dChip (27). Differences in gene expression between the trained and untrained mice were evaluated using unpaired t-test with unequal variances. A P value <0.05 was considered significant.

The functions of the genes were assigned according to NetAffx gene ontology annotations (www.affymetrix.com/analysis). Each gene was assigned to different functional groups that belong to one of the following gene ontology categories: biological process, molecular function, and cell component. Note that one gene might belong to multiple functional groups. The identification of functional groups with significantly enriched gene numbers was performed using MAPPFinder 2.0 (9) (University of California at San Francisco; http://www.genmapp.org). Functional groups with an adjusted P value ≤ 0.05 (based on two-sided t-test) were considered statistically significant. The adjusted P values refer to the P values after adjustment for the multiple comparison errors. This is part of the output from pathway analysis tool MAPPFinder, as described previously (9). The data discussed in this publication have been deposited in NCBIs Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo/) and are accessible through GEO Series accession number GSE5297.

Statistics.   Differences between the trained and untrained groups were compared using an unpaired t-test with unequal variances. Two-tailed t-test was used in all cases, except when hypotheses being tested were clearly one-sided questions, which were translated to one-sided alternative hypotheses. The data for which we applied the one-tailed t-test include OGTT, area under glucose curve, REE, AMPK level, and AMPK-P/AMPK ratio (all of these have been shown to be changed with exercise). The remaining calculations used the two-tailed t-test. A P value ≤0.05 was considered significant. Regression analysis was performed to determine whether muscle mitochondrial ATP production capacity (MATPC) is related to SPA levels. The results are presented as means ± SE.

For the gene array, functional groups with an adjusted P value ≤0.05 were considered statistically significant and were calculated as previously described (9).


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
Exercise, energy metabolism, and activity levels.   Over the course of the 2-mo exercise period, the running speed was increased as the mice became more trained. On average, each mouse in the exercise group ran a total of 46,031 ± 2,931 m at a 25° incline. While maintaining the 25° incline, the mice increased their running distance at 2-wk intervals, with the average distance over the first interval at 7,040 ± 171 m/mouse, second interval at 10,704 ± 484 m/mouse, third interval at 11,857 ± 1,065 m/mouse, and fourth interval at 16,430 ± 1,715 m/mouse. In comparison, over the 2-mo exercise period, the control mice ran a total distance of 3,240 m at a 0° incline to maintain familiarization with the treadmill.

Treadmill exercise increased VO2 peak (ml·kg FFM–1·min–1) by 18.9% (P < 0.01). (Fig. 1, untrained n = 12 and trained n = 8). There was no significant difference between the total body weight (untrained: 29.0 ± 0.6 g, trained: 30.2 ± 0.4 g; P < 0.13, two-sided t-test) mice or FFM (untrained: 21.3 0 ± 0.7 g, trained: 21.2 ± 0.4 g; P < 0.96, two-sided t-test) of the mice as measured by DXA. Total fat, expressed as total fat percentage (–19.5%; P < 0.01) and abdominal fat, expressed as abdominal fat percentage (–25.4%; P < 0.02) declined in the trained group (Fig. 2; untrained n = 12, trained n = 9).


Figure 1
View larger version (10K):
[in this window]
[in a new window]

  		Fig. 1. Training increased peak oxygen consumption [VO2 peak: ml·kg fat-free mass (FFM)–1·min–1]. The VO2 peak was significantly higher in trained (+18.9%; P < 0.01; two-sided t-test) than in untrained mice. Results are reported as means ± SE. Number of mice: untrained (n = 12) and trained (n = 8).

 

Figure 2
View larger version (11K):
[in this window]
[in a new window]

  		Fig. 2. Training effects on dual X-ray absorption (DXA) determined body composition. Training reduced the percentage of abdominal fat (–25.4%; P < 0.02, two-sided t-test) and total fat (–19.5%; P < 0.01, two-sided t-test) but did not alter total body weight (P < 0.13, two-sided t-test) and FFM (P < 0.96, two-sided t-test). The percentage of abdominal fat and total fat was measured as fat content relative to the quantity of abdominal tissue and total body tissue, respectively. Results are reported as means ± SE. Number of mice: untrained (n = 12), trained (n = 9).

 
REE and SPA were measured by placing the mice in a sealed metabolic chamber for 24 h. The REE was measured from the time period when animals were not physically active (Fig. 3, left; untrained n = 8 and trained n = 8). The REE was higher in the trained (0.69 ± 0.03 kcal/h) than the untrained mice (0.61 ± 0.01 kcal/h; P < 0.02). Physical activity results were reported as beam breaks over 19 h of measurement to maintain a consistent observational time period for each animal and included all activity (i.e., horizontal, vertical, ambulatory) throughout the light/dark cycle. There was a clear trend of difference in the physical activity level (Fig. 3, right) of the mice, with the trained mice having higher activity (63,069 ± 4,936 beam breaks) than the untrained mice (49,349 ± 4,892 beam breaks). Overall activity increase +27.8% (P = 0.056, two-tailed t-test). The number of "movement episodes," a session of continuous activity, defined by no activity before and after the session, tended to be higher in the trained mice (trained: 86 ± 3 episodes/h, untrained: 78 ± 11 episodes/h; P = 0.13, two-tailed t-test), although it did not reach statistical significance.


Figure 3
View larger version (9K):
[in this window]
[in a new window]

  		Fig. 3. Training effects on resting energy expenditure and activity. Left: training increased resting energy consumption (+12.4%, P < 0.02, one-sided t-test). Right: training increased activity (P = 0.056, two-sided t-test). Results are reported as means ± SE. Number of mice: untrained (n = 8), trained (n = 8).

 
Glucose tolerance.   Treadmill exercise tended to improved glucose tolerance, as determined by OGTT (trained n = 8 and untrained n = 10). Glucose levels were lower in the trained animals (Fig. 4, left) with a decline in the OGTT area under the curve in the trained vs. untrained group (–26.2%; P < 0.04, one-sided t-test) (Fig. 4, middle). Insulin levels were comparable (P < 0.50) between the trained and untrained group (Fig. 4, right).


Figure 4
View larger version (7K):
[in this window]
[in a new window]

  		Fig. 4. Training effects on oral glucose tolerance. Left: after a glucose load (2 g/kg), blood was collected over 120 min and measured using the glucose oxidase method (One Touch Profile). Middle: oral glucose tolerance test (OGTT) showed a decline in the area under the curve (AUC) in the trained vs. untrained group (–26.2%; P < 0.04, one-sided t-test). Right: insulin levels were comparable (P < 0.50, two-sided t-test) between the trained and untrained group. Number of mice: untrained (n = 10), trained (n = 8). *P value <0.05 (one-sided t-test) when comparing glucose values at equivalent time points.

 
Muscle mitochondrial function, DNA copy numbers, and transcription factors.   Treadmill exercise improved mitochondrial enzyme activity (Fig. 5, untrained n = 8, trained n = 8) as measured by CS (+18.3%; P < 0.02), BHAD (+20.5%; P < 0.04), or COX (+43.8%; P < 0.02) (Fig. 5, top). Training also improved MATPC of muscle homogenate, regardless of whether GM (+30.5%; P < 0.01), PCM (+28.9%; P < 0.04; two-sided t-test), or SR (+32.4%; P < 0.02) was used as substrates (Fig. 5, bottom).


Figure 5
View larger version (12K):
[in this window]
[in a new window]

  		Fig. 5. Training effects on mitochondrial function. Top: training improved mitochondrial activity as measured by citrate synthase (+18.3%; P < 0.02, two-sided t-test), L-3-hydroxyacyl coenzyme A dehydrogenase (BHAD) (+20.5%; P < 0.04, two-sided t-test), or cytochrome-c oxidase (+43.8%; P < 0.02, two-sided t-test). Bottom: training improved mitochondrial ATP production capacity using either glutamate+malate (GM; +30.5%; P < 0.01, two-sided t-test), palmitoyl-L-carnitine+malate (PCM; +28.9%; P < 0.04, two-sided t-test), or succinate+rotenone (SR; +32.4%; P < 0.02, two-sided t-test) as substrate. Number of mice: untrained n = (8), trained (n = 8).

 
Regression analysis showed that MATPC from the muscle homogenate while using PCM (r2 = 0.54, P < 0.007) and SR (r2 = 0.44, P < 0.02) as substrates significantly correlated to spontaneous activity levels. No significant correlation with activity levels (r2 = 0.095, P < 0.3) was observed when ATP production was measured using GM as substrate.

Treadmill exercise was associated with increased mtDNA copy number as measured by NADH 1 (+110%; P < 0.05) or NADH 4 (+88.4%, P < 0.01; two-sided t-test) (Fig. 6, left). Training also increased mitochondrial transcription factors such as TFAM mRNA (+21.7%; P < 0.01) (Fig. 6, middle) and PGC-1{alpha} protein (+99.5%; P < 0.04; two-sided t-test) and AMPK-P/AMPK (+82.1%; P < 0.09) (Fig. 6, right, untrained n = 6, and trained n = 10). AMPK-P level tended to change with exercise, but AMPK (total) did not change with exercise, with AMPK in the trained group measuring 0.35 ± 0.05 (n = 10) and 0.45 ± 0.04 (n = 6) in the untrained group (P < 0.10; one-sided t-test). Representative Western blot images are provided in Fig. 7 (AMPK, left; AMPK-P, middle; PGC-1, right).


Figure 6
View larger version (8K):
[in this window]
[in a new window]

  		Fig. 6. Left: training effects on mitochondrial DNA copy number. Training increased mitochondrial DNA copy number as measured by NADH 1 (+110%; P < 0.05, two-sided t-test) or NADH 4 (+88.4%; P < 0.01, two-sided t-test). Results are normalized to 28S rRNA. Number of mice: untrained (n = 9), trained (n = 9). Middle: training effects on mitochondrial transcription factor (TFAM) and peroxisome proliferative-activated receptor-{gamma} coactivator (PGC)-1{alpha} mRNA levels. Training increased TFAM mRNA levels (+21.7%; P < 0.01, two-sided t-test) but not PGC-1{alpha} mRNA levels (+29.9%; P < 0.25, two-sided t-test). Number of mice: untrained (n = 7), trained (n = 7). Right: training effects on the ratio between phosphorylated AMP-activated protein kinase (AMPK-P) to AMP-activated protein kinase (AMPK) and PGC-1{alpha} protein level. Training effects on AMPK-P/AMPK levels (+82.1%; P < 0.09, one-sided t-test). Training increased PGC-1{alpha} protein levels (+99.5%; P < 0.04, two-sided t-test). Number of mice: untrained (n = 6), trained (n = 10).

 

Figure 7
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 7. Representative Western Blots of AMPK protein (left), AMPK-P protein (middle), and PGC-1 protein (right) for untrained (UT) and trained (T) mice. Molecular weight markers (kDa) are reported on the left side of the corresponding gel.

 
Gene array results.   Of the 22,691 sequences represented on the array, 877 were differentially expressed between the trained and untrained groups. As a simple t-test to identify differentially expressed genes without adjusting for multiple-comparison errors often results in a larger fraction of false positives, we focused on the statistically significantly changed gene groups (ontology groups) identified by MappFinder. We ranked ontology groups by the adjusted P values and reported only the gene groups with adjusted P < 0.05. The top-rated cellular component terms were mitochondrion (Z score 13.80, P < 0.001), mitochondrial ribosome (Z score 11.08, P < 0.001), inner membrane genes (Z score 8.16, P < 0.001), mitochondrial small ribosomal subunit (Z score 8.11, P < 0.001), mitochondrial inner membrane (Z score 7.38, P < 0.001), mitochondrial membrane (Z score 7.02, P = 0.003), mitochondrial electron transport chain (Z score 6.76, P = 0.036), and mitochondrial large ribosomal subunit (Z score 6.64, P = 0.036). The top-ranked molecular function terms were as follows: monovalent inorganic cation transporter activity (Z score 7.91, P < 0.001), hydrogen ion transporter activity (Z score 7.91, P < 0.001), NADH dehydrogenase activity (Z score 7.30, P < 0.001), structural constituent of ribosome (Z score 7.00, P = 0.003), and cation transporter activity (Z score 6.68, P = 0.036). The majority of these ontology groups exhibiting significant changes were mitochondria and mitochondrial functions related, suggesting that treadmill exercise significantly increased mitochondrial function and mitochondrial biogenesis. The top-ranked ontology groups are noted in Table 1. Table 2 provides specific gene changes observed with training.


View this table:
[in this window]
[in a new window]

  		Table 1. Ontology group results: trained vs. untrained mice

 

View this table:
[in this window]
[in a new window]

  		Table 2. Specific gene changes: trained vs. untrained mice

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 
The present study demonstrated that aerobic exercise training enhances muscle mitochondrial function, along with an increase in nuclear transcription factors, mtDNA content, transcript levels of both nuclear and mitochondrial genes involved in mitochondrial function, and that this increase in mitochondrial function occurs in association with an increase in SPA. The endurance training program of 8 wk, as expected, enhanced maximum oxygen capacity, glucose tolerance, and muscle mitochondrial enzyme activity, with associated decreases in total and abdominal fat percentage. We demonstrated that treadmill exercise training increased in vitro muscle MATPC. Analysis of the Affymetrix gene array results showed significant differences in many gene transcripts, particularly mitochondria-related ontology groups, between the trained and untrained mice. The observed differences in gene transcripts involve not only the genes in electron transport chain, but also genes involved in the structure and function of mitochondria. The differences in mitochondrial gene transcripts and functions were associated with an increase in mtDNA copy number. This enhancement of mtDNA content, mitochondria-related gene transcripts, and mitochondrial function is associated with increases in levels of skeletal muscle PGC-1{alpha} protein expression and TFAM mRNA, which are known mitochondrial transcription factors. The study also demonstrated that aerobic exercise training tended to increase SPA, which was significantly correlated to muscle MATPC.

Our goal was to maximally train each mouse by maintaining a tailored running speed, which maintained oxygen consumption at 80–90% of VO2 peak. This aerobic exercise program increased VO2 peak (+18.9%; P < 0.01) and enhanced muscle mitochondrial function, as demonstrated by higher levels of mitochondrial enzyme activity (CS +18.3%; P < 0.02, BHAD +20.5%; P < 0.04, COX +43.8%; P < 0.02) and muscle MATPC (+29.0 to 33.7%, depending on utilized substrate; P < 0.04). This is consistent with previous reports of enhanced muscle mitochondrial oxidative enzyme activity (twofold) with training of rats (initial age: 6 wk old) for 12 wk (18) and adult humans trained for 4 mo (cycling program, 4 days/wk, 40 min/session, training speed elicited 80% of maximal heart rate; VO2 peak increase of 10%, 45–76% elevation of muscle mitochondrial enzyme activity) (48, 49). The differences in magnitude of exercise effects on mitochondrial function between our findings and previously reported results may be related to the differences in the exercise program or to intraspecies variation in exercise response.

In mammalian tissues, oxidative capacity correlates with mitochondrial copy number (55). Here we report aerobic exercise increased in vitro MATPC in parallel with an increase in mtDNA abundance (+88.4–110%, P < 0.05). Previously, mtDNA abundance has been shown to decline with age in rats, with slow-twitch predominantly oxidative skeletal muscles more affected than fast-twitch glycolytic predominant skeletal muscle or the heart (2). We hypothesized that the heart, despite being a highly oxidative tissue, prevented age-related mtDNA decline because of the continuous contractile activity. The present data support that chronic aerobic exercise enhances muscle mtDNA abundance. Previous studies in rodents (4, 7, 19, 35) and humans (20, 22, 59) have shown that aerobic exercise enhances not only mitochondrial enzyme activities, but also mitochondrial volume and content. Studies comparing young and older rodents (2) and humans (45) suggest that mtDNA abundance (template availability) is a key factor for maintaining transcript levels of mitochondrial proteins encoded by mitochondria. After 8 wk of treadmill training, our trained mice showed an increase in mtDNA abundance, mRNA transcripts (encoded by both nuclear and mitochondrial genes) of mitochondrial proteins, mitochondrial enzyme activity, and mitochondrial ATP production. These findings support that increase in mtDNA abundance is key in muscle adaptation to chronic exercise. There is, however, a discrepancy between the magnitude of increase in mtDNA copy number (+88.4–110%, P < 0.05) and the relatively moderate increase in mitochondrial enzyme activity (+18.3 to +43.8%; P < 0.04) and MATPC (+29.0–33.7%, depending on utilized substrate; P < 0.04). These results are different from older humans (age 67.3 ± 0.6 yr) subjected to an aerobic training program (12 wk: VO2 peak +15 ± 4%; P < 0.01), with subsequent increases in mtDNA (+ 53 ± 15%; P < 0.01) and succinate dehydrogenase activity (+62 ± 13%; P < 0.01) (33). This may be related to intraspecies variation in turnover of mitochondrial proteins or translation of the mitochondrial genome, for which further studies will be needed to elaborate.

The present study demonstrated that aerobically trained mice have increased expression of PGC-1{alpha} protein (+99.5%; P = 0.04) and increased mRNA levels of TFAM (+21.7%; P = 0.004). The increase in mtDNA copy number and mitochondrial biogenesis depends on increasing transcription factors of mitochondria-related genes at the nuclear and mitochondrial genome levels. For enhancement of mitochondrial function, it is important to have increased synthesis of both mitochondrial and nuclear gene-encoded (~13% of all mitochondrial proteins are encoded by mitochondrial genes, and the rest are encoded by nuclear genes) proteins. Moreover, the nuclear-encoded proteins which are synthesized in cytoplasm, have to be transported into mitochondria to facilitate mitochondrial function. PGC-1{alpha} was first described as a coactivator for peroxisome proliferator-activated receptor-{gamma} in adaptive thermogenesis, the regulation of heat production in response to cold exposure (41). Subsequently, overexpression of PGC-1{alpha} has been shown to increase type 1 fibers (29) and mitochondrial biogenesis in skeletal muscle (58). Key cellular signals that control energy and nutrient homeostasis, such as cAMP and cytokine pathways, activate PGC-1{alpha} (40). Once PGC-1{alpha} is activated, it induces and coordinates mitochondrial oxidative metabolism. TFAM, a protein critical for mtDNA transcription and replication (12, 24, 38), is stimulated by PGC-1{alpha}. Nuclear respiratory factors-1 and -2 are transcriptional coactivators that enhance nuclear genes involved in mitochondrial biogenesis. Both acute exercise (4-wk-old rats subjected to 6-h swimming session) (52) and chronic (3- to 4-wk-old rats subjected to swimming, 2 h/day, 3–7 days duration) (15) exercise increased PGC-1{alpha} mRNA levels in skeletal muscle. Increase in mRNA expression of PGC-1{alpha} has also been shown to occur in human skeletal muscle following an aerobic exercise training program (49). Although we did not find an increase in PGC-1{alpha} mRNA levels, we found an increase in protein levels of PGC-1{alpha} in mice following chronic exercise (+99.5%; P = 0.04). This discrepancy between mRNA and protein levels of PGC-1{alpha} may be due to the timing of tissue collection (at least 24 h) after the last exercise bout. Alternatively, the effects of our treadmill exercise program in increasing PGC-1{alpha} levels may be at the level of translation rather than transcription. A similar discrepancy between increased PGC-1{alpha} protein without an increase in mRNA levels has been previously reported in adipose tissue (53).

Previous studies have also shown that muscle contractile activity and aerobic exercise increase the AMPK activity (11, 14) and may act as a signal to PGC-1{alpha}. The lack of exercise-associated increase in AMPK protein levels (trained group = 0.35 ± 0.05 and untrained group = 0.45 ± 0.04; P < 0.10 ) is consistent with previous findings from chronic treadmill exercise in rats (11). In contrast, chronic exercise has been shown to increase the AMPK {alpha}1-isoform in humans and not the {alpha}2-isoform in humans (13). This discrepancy in the nonuniform increases of AMPK protein could be due to the training itself or to the species adaptation to training. We did observe a trend for exercise increasing AMPK-P (AMPK-P/AMPK; +82.1%, P = 0.09) in our mice, which is consistent with previous reports of exercise increasing AMPK activity in rats (11) and in humans (13).

Previously, gene array analysis of 3-mo aerobic exercise training (80% of VO2 peak) in elderly men has shown expression of some of the genes linked with energy metabolism, protein amino acid dephosphorylation, and heme biosynthesis (42). Here we report an Affymetrix gene array analysis of murine muscle subjected to treadmill exercise, where we demonstrated upregulation of a cluster mitochondrial-related gene group (Tables 1 and 2). These gene array changes have not yet been reported in mice subjected to treadmill exercise training and lay the foundation for identifying the transcriptional changes associated with benefits from aerobic exercise training.

Although total body weight and FFM of the trained and untrained mice remained statistically similar, we saw a decline in the percentage of total body and abdominal fat. The discrepancy between the lack of change in total body weight/FFM, coupled with the decline in percentage of total and abdominal body fat, may be due to differences in bone density between the trained and untrained group, or variability in the DXA measurement of fat and FFM (6).

Our study reports the important and novel observation that an aerobic exercise program may enhance SPA. In animals, long-term exercise training generally increases REE, although a specific increase in nonexercise activity has not yet been reported (50). In humans, the effects of long-term aerobic or strength activity on REE has been mixed (50), with specific effects on nonexercise activity not yet reported. Some studies in humans suggest that, in elderly people, changes in REE are negatively correlated with the preexercise REE, and increase in REE following exercise is compensated for by a corresponding decrease in nonexercise physical activity (mostly SPA) (31).

The importance of physical activity is highlighted by the age-related decline in activity levels observed in a wide range of species (5, 16, 37). Whereas voluntary activities are cognitively controlled, there is increasing evidence to show that spontaneous activities are regulated by paraventricular nucleus of hypothalamus (23). Since age-related muscle mitochondrial function decreases with age (46), it was hypothesized that muscle MATPC is a determinant of SPA (36). Although the present study supports the above hypothesis, it remains to be determined whether aerobic exercise training per se or increased MATPC caused increased SPA levels. The activity levels were significantly correlated to the two separate measures of muscle mitochondrial ATP production, and the results support the previous hypothesis (36) that SPA levels are related to muscle mitochondrial capacity. This is a finding of substantial interest and suggests that increasing voluntary activity levels for a specific period of time will increase SPA levels. Our results have substantial implications. Studies in C. elegans indicate that longevity of the organism is related to the ability to maintain activity levels (17). Moreover, obesity is increasing in the aging population, and obesity in general is related to reduced nonexercise activity thermogenesis (25). Further studies will be needed to determine whether our results can be extended to humans, specifically to assess whether increasing voluntary physical activity increases SPA levels in an aging population.

Exercise plays a critical component in maintaining health, with increasing age associated with increased sarcopenia (32), decreased mitochondrial function (48), and decreased synthesis of mitochondrial proteins (44) in humans. Exercise, particularly aerobic exercise, has been shown to improve skeletal muscle mitochondrial function (48). However, aerobic exercise is not a viable option in all populations. Our observation that the stimulation of SPA is associated with an increase in muscle mitochondrial function, muscle mtDNA content, and mitochondrial enhancing nuclear transcription factors suggests possible strategies to prevent or delay age/obesity-related problems in our society. Such potential strategies, for example, may include measures to stimulate the nuclear transcription factors regulating mitochondrial biogenesis.

In summary, we have demonstrated that treadmill training stimulates in vitro muscle MATPC, transcript levels of both nuclear and mitochondrial genes regulating in mitochondrial proteins, expression of PGC-1{alpha} and mRNA of TFAM (involved in mitochondrial biogenesis), and mtDNA copy numbers. These findings are consistent with an interpretation that an aerobic exercise program enhances mitochondrial function through increasing mtDNA content and that this increase in mitochondrial function is associated with an increase in SPA. The present study supports that exercise increases PGC-1{alpha} protein levels, with subsequent increase in TFAM mRNA levels to increase mtDNA replication. Increased mRNA levels encoded by both nuclear and mitochondrial genes are likely resulted from increased PGC-1{alpha} that contributes to increased mitochondrial capacity. Increased mtDNA content is likely a reflection of increased muscle mitochondrial content. The observation that SPA levels are associated with increases in muscle MATPC suggests that a decline in muscle mitochondrial function may cause a reduction in SPA levels, resulting in alterations in overall energy balance and obesity-related metabolic disorders.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
ACKNOWLEDGMENTS
 REFERENCES
 
Support was provided by National Institute on Aging Grant RO1-AG09531, the Mayo Foundation, the Dole-Murdock Professorship (K. S. Nair), and National Research Service Award T32-DK07352 (L. S. Chow).


   ACKNOWLEDGMENTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
REFERENCES
 
We thank Jill Schimke, Kate Klaus, Dawn Morse, Shelly McCrady, and Dr. Colleen Novak for technical assistance in performing the study.


   FOOTNOTES
 

Address for reprint requests and other correspondence: K. Sreekumaran Nair, Division of Endocrinology, Nutrition and Metabolism, Mayo Clinic College of Medicine, 200 First St. SW; Rochester, MN 55905 (E-mail: nair.sree{at}mayo.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 ACKNOWLEDGMENTS
 REFERENCES
 

  1. Balagopal P, Schimke JC, Ades P, Adey D, Nair KS. Age effect on transcript levels and synthesis rate of muscle MHC and response to resistance exercise. Am J Physiol Endocrinol Metab 280: E203–E208, 2001.[Abstract/Free Full Text]
  2. Barazzoni R, Short KR, Nair KS. Effects of aging on mitochondrial DNA copy number and cytochrome c oxidase gene expression in rat skeletal muscle, liver, and heart. J Biol Chem 275: 3343–3347, 2000.[Abstract/Free Full Text]
  3. Billat VL, Mouisel E, Roblot N, Melki J. Inter- and intrastrain variation in mouse critical running speed. J Appl Physiol 98: 1258–1263, 2005.[Abstract/Free Full Text]
  4. Bizeau ME, Willis WT, Hazel JR. Different responses to endurance training in subsarcolemmal and intramyofibrillar mitochondria. J Appl Physiol 85: 1279–1284, 1998.[Abstract/Free Full Text]
  5. Black AE, Coward WA, Cole TJ, Prentice AM. Human energy expenditure in affluent societies: an analysis of 574 doubly-labelled water measurements. Eur J Clin Nutr 50: 72–92, 1996.[Web of Science][Medline]
  6. Brommage R. Validation and calibration of DEXA body composition in mice. Am J Physiol Endocrinol Metab 285: E454–E459, 2003.[Abstract/Free Full Text]
  7. Davies KJA, Packer L, Broooks GA. Biochemical adaptation of mitochondria, muscle, and whole-animal respiration to endurance training. Arch Biochem Biophys 209: 539–554, 1981.[CrossRef][Web of Science][Medline]
  8. Demirel HA, Powers SK, Naito H, Hughes M, Coombes JS. Exercise-induced alterations in skeletal muscle myosin heavy chain phenotype: dose-response relationship. J Appl Physiol 86: 1002–1008, 1999.[Abstract/Free Full Text]
  9. Doniger SW, Salomonis N, Dahlquist KD, Vranizan K, Lawlor SC, Conklin BR. MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data. Genome Biol 4: R7, 2003.[CrossRef][Medline]
  10. Dudley GA, Abraham WM, Terjung RL. Influence of exercise intensity and duration on biochemical adaptations in skeletal muscle. J Appl Physiol 53: 844–850, 1982.[Abstract/Free Full Text]
  11. Durante PE, Mustard KJ, Park SH, Winder WW, Hardie DG. Effects of endurance training on activity and expression of AMP-activated protein kinase isoforms in rat muscles. Am J Physiol Endocrinol Metab 283: E178–E186, 2002.[Abstract/Free Full Text]
  12. Fisher RP, Clayton DA. Purification and characterization of human mitochondrial transcription factor 1. Mol Cell Biol 8: 3496–3509, 1988.[Abstract/Free Full Text]
  13. Frosig C, Jorgensen SB, Hardie DG, Richter EA, Wojtaszewski JFP. 5'-AMP-activated protein kinase activity and protein expression are regulated by endurance training in human skeletal muscle. Am J Physiol Endocrinol Metab 286: E411–E417, 2004.[Abstract/Free Full Text]
  14. Fryburg DA, Louard RJ, Gerow KE, Gelfand RA, Barrett EJ. Growth hormone stimulates skeletal muscle protein synthesis and antagonizes insulin's antiproteolytic action in humans. Diabetes 41: 424–429, 1992.[Abstract]
  15. Goto M, Terada S, Kato M, Katoh M, Yokozeki T, Tabata I, Shimokawa T. cDNA cloning and mRNA analysis of PGC-1 in epitrochlearis muscle in swimming-exercised rats. Biochem Biophys Res Commun 274: 350–354, 2000.[CrossRef][Web of Science][Medline]
  16. Herndon LA, Schmeissner PJ, Dudaronek JM, Brown PA, Listner KM, Sakano Y, Paupard MC, Hall DH, Driscoll M. Stochastic and genetic factors influence tissue-specific decline in ageing C. elegans. Nature 419: 808–814, 2002.
  17. Herndon LA, Schmeissner PJ, Dudaronek JM, Brown PA, Listner KM, Sakano Y, Paupard MC, Hall DH, Driscoll M. Stochastic and genetic factors influence tissue-specific decline in ageing C. elegans [see comment]. Nature 419: 808–814, 2002.[CrossRef][Medline]
  18. Holloszy JO. Biochemical adaptations in muscle. Effects of exercise on mitochondrial oxygen uptake and respiratory enzyme activity in skeletal muscle. J Biol Chem 242: 2278–2282, 1967.[Abstract/Free Full Text]
  19. Holloszy JO. Effects of exercise on mitochondrial oxygen uptake and respiratory enzyme activity in skeletal muscle. J Biol Chem 242: 2278–2282, 1967.[Abstract/Free Full Text]
  20. Howald H, Hoppeler H, Claasen H, Mathieu O, Straub R. Influences of endurance training on the ultrastructural composition of the different muscle fiber types in humans. Pflugers Arch 403: 369–376, 1985.[CrossRef][Web of Science][Medline]
  21. Kemi OJ, Loennechen JP, Wisloff U, Ellingsen O. Intensity-controlled treadmill running in mice: cardiac and skeletal muscle hypertrophy. J Appl Physiol 93: 1301–1309, 2002.[Abstract/Free Full Text]
  22. Kiessling KH, Pilstrom L, Karlsson J, Piehl K. Mitochondrial volume in skeletal muscle from young and old physically untrained and trained healthy men and from alcoholics. Clin Sci 44: 547–554, 1973.[Web of Science][Medline]
  23. Kiwaki K, Kotz CM, Wang C, Lanningham-Foster L, Levine JA. Orexin A (hypocretin 1) injected into hypothalamic paraventricular nucleus and spontaneous physical activity in rats. Am J Physiol Endocrinol Metab 286: E551–E559, 2004.[Abstract/Free Full Text]
  24. Larsson NG, Wang J, Wilhelmsson H, Oldfors A, Rustin P, Lewandoski M, Barsh GS, Clayton DA. Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nat Genet 18: 231–236, 1998.[CrossRef][Web of Science][Medline]
  25. Levine JA, Lanningham-Foster LM, McCrady SK, Krizan AC, Olson LR, Kane PH, Jensen MD, Clark MM. Interindividual variation in posture allocation: possible role in human obesity. Science 307: 584–586, 2005.[Abstract/Free Full Text]
  26. Levine JA, Nygren J, Short KR, Nair KS. Effect of hyperthyroidism on spontaneous physical activity and energy expenditure in rats. J Appl Physiol 94: 165–170, 2003.[Abstract/Free Full Text]
  27. Li C, Wong WH. Model-based analysis of oligonucleotide arrays: expression index computation and outlier detection. Proc Natl Acad Sci USA 98: 31–36, 2001.[Abstract/Free Full Text]
  28. Lightfoot JT, Turner MJ, Debate KA, Kleeberger SR. Interstrain variation in murine aerobic capacity. Med Sci Sports Exerc 33: 2053–2057, 2001.
  29. Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, Michael LF, Puigserver P, Isotani E, Olson EN, Lowell BB, Bassel-Duby R, Spiegelman BM. Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres. Nature 418: 797–801, 2002.[CrossRef][Medline]
  30. Massett MP, Berk BC. Strain-dependent differences in responses to exercise training in inbred and hybrid mice. Am J Physiol Regul Integr Comp Physiol 288: R1006–R1013, 2005.[Abstract/Free Full Text]
  31. Meijer EP, Westerterp KR, Verstappen FT. Effect of exercise training on physical activity and substrate utilization in the elderly. Int J Sports Med 21: 499–504, 2000.[CrossRef][Web of Science][Medline]
  32. Melton LJ 3rd, Khosla S, Riggs BL. Epidemiology of sarcopenia. Mayo Clinic Proc 75, Suppl: S10–S13, 2000.
  33. Menshikova EV, Ritov VB, Fairfull L, Ferrell RE, Kelley DE, Goodpaster BH. Effects of exercise on mitochondrial content and function in aging human skeletal muscle. J Gerontol A Biol Sci Med Sci 61: 534–540, 2006.[Abstract/Free Full Text]
  34. Michikawa Y, Mazzucchelli F, Bresolin N, Scarlato G, Attardi G. Aging-dependent large accumulation of point mutations in the human mtDNA control region for replication. Science 286: 774–779, 1999.[Abstract/Free Full Text]
  35. Muller H. Subsarcolemmal mitochondria and capillarization of soleus muscle fibers in young rats subjected to an endurance training. Cell Tissue Res 174: 367–389, 1976.[CrossRef][Web of Science][Medline]
  36. Nair KS. Aging muscle. Am J Clin Nutr 81: 953–963, 2005.[Abstract/Free Full Text]
  37. Nemoz-Bertholet F, Aujard F. Physical activity and balance performance as a function of age in prosimian primate (Microcebus murinus). Exp Gerontol 38: 407–414, 2003.[CrossRef][Web of Science][Medline]
  38. Parisi MA, Clayton DA. Similarity of human mitochondrial transcription factor 1 to high mobility group proteins. Science 252: 965–969, 1991.[Abstract/Free Full Text]
  39. Petersen KF, Dufour S, Befroy D, Garcia R, Shulman GI. Impaired mitochondrial activity in the insulin-resistant offspring of patients with type 2 diabetes. N Engl J Med 350: 664–671, 2004.[Abstract/Free Full Text]
  40. Puigserver P, Spiegelman BM. Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1 alpha): transcriptional coactivator and metabolic regulator. Endocr Rev 24: 78–90, 2003.[Abstract/Free Full Text]
  41. Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman BM. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92: 829–839, 1998.[CrossRef][Web of Science][Medline]
  42. Radom-Aizik S, Ben-Dov I, Shahar I, Rechavi G, Kaminski N, Hayek S. Effects of aerobic training on gene expression in skeletal muscle of elderly men. Med Sci Sports Exerc 37: 1680–1696, 2005.
  43. Robinson JB, Brent LG, Sumgei B, Srere PA. An enzymatic approach to the study of the Krebs tricarboxylic acid cycle. In: Mitochondria. A Practical Approach, edited by Darley-Usmar VM. Oxford, UK: IRL, 1987, p. 153–170.
  44. Rooyackers OE, Adey DB, Ades PA, Nair KS. Effect of age on in vivo rates of mitochondrial protein synthesis in human skeletal muscle. Proc Natl Acad Sci USA 93: 15364–15369, 1996.[Abstract/Free Full Text]
  45. Short KR, Bigelow ML, Kahl J, Coenen-Schimke J, Raghavakaimal S, Nair KS, Singh R. Decline in skeletal muscle mitochondrial function with aging in humans. Proc Natl Acad Sci USA 102: 5618–5623, 2005.[Abstract/Free Full Text]
  46. Short KR, Bigelow ML, Kahl J, Singh R, Coenen-Schimke J, Raghavakaimal S, Nair KS. Decline in skeletal muscle mitochondrial function with aging in humans. Proc Natl Acad Sci USA 102: 5618–5623, 2005.[Abstract/Free Full Text]
  47. Short KR, Nygren J, Barazzoni R, Levine J, Nair KS. T3 increases mitochondrial ATP production in oxidative muscle despite increased expression of UCP2 and -3. Am J Physiol Endocrinol Metab 280: E761–E769, 2001.[Abstract/Free Full Text]
  48. Short KR, Vittone JL, Bigelow ML, Proctor DN, Nair KS. Age and aerobic exercise training effects on whole body and muscle protein metabolism. Am J Physiol Endocrinol Metab 286: E92–E101, 2004.[Abstract/Free Full Text]
  49. Short KR, Vittone JL, Bigelow ML, Proctor DN, Rizza RA, Coenen-Schimke JM, Nair KS. Impact of aerobic exercise training on age-related changes in insulin sensitivity and muscle oxidative capacity. Diabetes 52: 1888–1896, 2003.[Abstract/Free Full Text]
  50. Speakman JR, Selman C. Physical activity and resting metabolic rate. Proc Nutr Soc 62: 621–634, 2003.[CrossRef][Web of Science][Medline]
  51. Stump CS, Short KR, Bigelow ML, Schimke JM, Nair KS. Effect of insulin on human skeletal muscle mitochondrial ATP production, protein synthesis, and mRNA transcripts. Proc Natl Acad Sci USA 100: 7996–8001, 2003.[Abstract/Free Full Text]
  52. Terada S, Goto M, Kato M, Kawanaka K, Shimokawa T, Tabata I. Effects of low-intensity prolonged exercise on PGC-1 mRNA expression in rat epitrochlearis muscle. Biochem Biophys Res Commun 296: 350–354, 2002.[CrossRef][Web of Science][Medline]
  53. Tsukiyama-Kohara K, Poulin F, Kohara M, DeMaria CT, Cheng A, Wu Z, Gingras AC, Katsume A, Elchebly M, Spiegelman BM, Harper ME, Tremblay ML, Sonenberg N. Adipose tissue reduction in mice lacking the translational inhibitor 4E-BP1. Nat Med 7: 1128–1132, 2001.[CrossRef][Web of Science][Medline]
  54. Wibom R, Hultman E. ATP production rate in mitochondria isolated from microsamples of human muscle. Am J Physiol Endocrinol Metab 259: E204–E209, 1990.[Abstract/Free Full Text]
  55. Williams R. Mitochondrial gene expression in mammalian striated muscle. Evidence that variation in gene dosage is the major regulatory event. J Biol Chem 261: 12390–12394, 1986.[Abstract/Free Full Text]
  56. Winder WW, Holmes BF, Rubink DS, Jensen EB, Chen M, Holloszy JO. Activation of AMP-activated protein kinase increases mitochondrial enzymes in skeletal muscle. J Appl Physiol 88: 2219–2226, 2000.[Abstract/Free Full Text]
  57. Wu H, Kanatous SB, Thumond FA, Gallardo T, Isotani E, Bassel-Duby R, Williams RS. Regulation of mitochondrial biogenesis in skeletal muscle by CaMK. Science 296: 349–352, 2002.[Abstract/Free Full Text]
  58. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, Troy A, Cinti S, Lowell B, Scarpulla RC, Spiegelman BM. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98: 115–124, 1999.[CrossRef][Web of Science][Medline]
  59. Zamora AJ, Tessier F, Marconnet P, Margaritis I, Marini JF. Mitochondria changes in human muscle after prolonged exercise, endurance training and selenium supplementation. Eur J Appl Physiol 71: 505–511, 1995.



This article has been cited by other articles:


Home page
 Am. J. Clin. Nutr.Home page
I. R Lanza and K S. Nair
Muscle mitochondrial changes with aging and exercise
Am. J. Clinical Nutrition, January 1, 2009; 89(1): 467S - 471S.
[Abstract] [Full Text] [PDF]

Home page
 J. Appl. Physiol.Home page
J. A. Call, K. A. Voelker, A. V. Wolff, R. P. McMillan, N. P. Evans, M. W. Hulver, R. J. Talmadge, and R. W. Grange
Endurance capacity in maturing mdx mice is markedly enhanced by combined voluntary wheel running and green tea extract
J Appl Physiol, September 1, 2008; 105(3): 923 - 932.
[Abstract] [Full Text] [PDF]

Home page
 J. Physiol.Home page
S. V. Brooks, A. Vasilaki, L. M. Larkin, A. McArdle, and M. J. Jackson
Repeated bouts of aerobic exercise lead to reductions in skeletal muscle free radical generation and nuclear factor {kappa}B activation
J. Physiol., August 15, 2008; 586(16): 3979 - 3990.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
102/3/1078    most recent
00791.2006v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chow, L. S.
Right arrow Articles by Nair, K. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chow, L. S.
Right arrow Articles by Nair, K. S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.