Journal of Applied Physiology Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Appl Physiol 102: 755-761, 2007. First published October 26, 2006; doi:10.1152/japplphysiol.01503.2005
8750-7587/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
102/2/755    most recent
01503.2005v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, C. A.
Right arrow Articles by Stauber, W. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, C. A.
Right arrow Articles by Stauber, W. T.

Transforming growth factor-beta following skeletal muscle strain injury in rats

Cheryl A. Smith,1 Franciose Stauber,1 Christopher Waters,1 Stephen E. Alway,2 and William T. Stauber1

1Department of Physiology and Pharmacology and 2Laboratory of Muscle Biology and Sarcopenia, Division of Exercise Physiology, West Virginia University School of Medicine, Morgantown, West Virginia

Submitted 28 November 2005 ; accepted in final form 18 October 2006


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Transforming growth factor-beta (TGF-beta) is a multifunctional cytokine implicated in inflammatory processes, wound healing, and fibrosis. In muscle diseases (i.e., dystrophy and inflammatory myopathy) and in animal models of muscle injury (i.e., produced by cardiotoxin, laceration, and eccentric contractions), increased TGF-beta was associated with muscle fibrosis and healing. Although TGF-beta transcript abundance was increased following injury, many studies presume that TGF-beta protein was also active as evident by increases in collagen transcript abundance. The purpose was to determine whether TGF-beta protein is present and active 48 h following injury. Using female rats, muscle strains were produced by stretching (50 stretches) the plantar flexor muscles. Forty-eight hours following injury, the medial gastrocnemius was removed and compartmentalized into five equal segments. Damaged myofibers with intracellular concanavalin A staining were counted. The percentage of damaged myofibers was significantly greater in the distal-most segment. TGF-beta was assessed by using immunohistochemistry, RT-PCR, and immunoblot analysis. Immunohistochemistry revealed the presence of TGF-beta1 in areas of myofiber injury, whereas TGF-beta2 was not detected. Increases in TGF-beta1 and TGF-beta2 transcript abundance following strain injury were documented by RT-PCR analysis. Increases in TGF-beta1 and TGF-beta2 precursor abundance were observed following strain injury by using immunoblot analysis but there was no change in active TGF-beta abundance. Although there was no correlation between the amount of cellular injury and TGF-beta transcript and protein abundance, elevated levels of TGF-beta1 and TGF-beta2 precursor proteins were present in strain-injured skeletal muscles 48 h after injury.

acute injury; cytokine; gastrocnemius; muscle healing


ALTHOUGH CYTOKINES have been most extensively studied in the context of infectious diseases, several stimuli associated with muscle damage (e.g., shear or mechanical stress, reactive oxygen products, and stress hormones) can induce or modulate cytokine synthesis. Generally, it is thought that a complex mixture of cytokines controls the processes involved in muscle healing following injury. However, in the pathogenesis of various diseases, transforming growth factor-beta (TGF-beta) has been implicated as a prominent cytokine involved in tissue repair and remodeling.

TGF-beta is a multifunctional cytokine that exerts a wide range of biological effects on a large variety of cell types. TGF-beta is especially noted for its fibrogenic properties in many organ systems (i.e., lung, kidney, skin, liver) and is produced in response to injury (9). In skeletal muscle, TGF-beta has the ability to inhibit myogenic differentiation, myoblast fusion, and the expression of various muscle-specific proteins (17, 25). In addition, TGF-beta has the ability to stimulate collagen synthesis, fibroblast proliferation, and angiogenesis (10, 24, 28).

In muscle diseases characterized by fibrosis such as muscular dystrophy (6, 7, 22) and inflammatory myopathy (13), TGF-beta has been localized to the extracellular matrix between myofibers and areas of inflammatory cell infiltration. In skeletal muscle injury, TGF-beta antagonists such as decorin, {gamma}-interferon, and suramin have been used to block the profibrotic effects of TGF-beta and improve muscle recovery (11, 12, 18, 20). In both skeletal muscle disease and injury, TGF-beta appears to be a major determinant for connective tissue proliferation and fibrosis (7, 11, 34). Although TGF-beta is typically regarded as a profibrotic cytokine, in vitro studies have shown that TGF-beta plays a role in delaying myogenesis. TGF-beta suppresses cell proliferation and delays myogenic differentiation (1, 25, 39) by altering Smad-3 signaling that represses the activity of myogenic regulatory factors (i.e., myoD, myogenin) (25). Therefore, an increase in TGF-beta production in response to chronic muscle injury may inhibit the repair of injured fibers and increase connective tissue production, thus propagating skeletal muscle weakness and fibrosis (11, 12, 18, 34).

In recent studies using microarray analysis, TGF-beta transcript abundance was increased 48 h following muscle injury produced by cardiotoxin (21) or eccentric contractions (5). Although TGF-beta transcript abundance was increased following muscle injury, an increase in transcript abundance may not reflect an increase in protein abundance or activity. Since TGF-beta is secreted in an inactive form and must be cleaved for activation (28, 33), the objective of this study was to provide evidence that TGF-beta transcript and protein are induced in response to skeletal muscle injury.

Since neutrophils and macrophages are rich sources of cytokines and are highly abundant 48 h following muscle injury (35, 37), we hypothesized that the increase in TGF-beta transcript and protein abundance would correlate with cellular injury. Also, since TGF-beta is associated with increased collagen synthesis, we hypothesized that TGF-beta would be present in the active form 48 h following injury.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals.   Female Sprague-Dawley (SD) rats (n = 11), weighing approximately 225–250 g each, were used in this study as approved by the West Virginia University Animal Care and Use Committee (ACUC #04–0704). Thus the use of rats was in compliance with the Animal Welfare Act P.L. 99–158 and Department of Health and Human Services guidelines governing the care and use of laboratory animals. All animals were provided clean cages, food and water ad libitum, and maintained on a 12:12-h light-dark cycle at 25°C.

To produce a strain injury, the animal's left plantar flexor group was electrically tetanized using field stimulation. While the animal was under isoflurane anesthesia, small electrodes attached to an electrical stimulator (Grass SD9, Grass Instruments, Quincy, MA) provided the field stimulation. The electrodes were placed directly under the skin and ran parallel to the left gastrocnemius muscle (i.e., one electrode medial, one electrode lateral). A tetanic contraction was produced using a stimulation frequency of 80 Hz and duration of 2 ms at 40 V. On stimulation, the foot was manually moved through its normal range of motion (estimated to be ~500°/s) to overcome the force generated by the stimulated plantar flexor group (i.e., stretched). Fifty stretches were performed with a 40-s rest between stretches. The right plantar flexor group served as a contralateral control.

Since neutrophils and macrophages are increased 48 h following an eccentric contraction-induced injury and may serve as a source of proinflammatory cytokines (i.e., TGF-beta) (10), the animals were killed 48 h following the strain injury. At death the animals were weighed and exsanguinated under deep anesthesia with pentobarbital sodium. The medial gastrocnemius muscle was removed and cut in cross section into five proportional segments ~5 mm in length. All segments were mounted with Histo Prep (Fisher Scientific) and frozen with isopentane cooled by liquid nitrogen. For the histochemical analysis, muscle segments were sectioned at 8 µm. Sections were collected from each segment and mounted on poly-L-lysine-coated glass slides and stored at –80°C until used. After sectioning, the remaining tissue from each segment was used for RNA and protein isolation.

Immunohistochemistry.   Localization of TGF-beta1 (polyclonal, Santa Cruz) and TGF-beta2 (polyclonal, Santa Cruz) was performed by indirect immunohistochemical techniques (36) by using a flourescein-conjugated secondary antibody (Chemicon). Briefly, slides were washed with phosphate-buffered saline (0.01 M sodium phosphate in 0.15 M NaCl, pH 7.4), blocked with 5% normal goat serum, and washed. Slides were incubated 30 min at room temperature in a moist chamber with diluted primary antibody and washed. Slides were incubated with secondary antibody and washed. Glass coverslips were applied over the tissue sections using a glycerin-PBS (1:1) solution. Tissue sections were viewed using a Leitz DAS fluorescence microscope, and 35-mm photographs were taken.

For morphometry, concanavalin A lectin (Con A, DAKO) and laminin (polyclonal, Sigma) were colocalized using a double-label protocol similar to a technique previously published (36). Con A directly labeled with Cy3 was used to label glycoproteins rich in mannose residues that appeared in the extracellular matrix (23) and within damaged myofibers (19). Laminin was used as a basal lamina marker. The number of Con A-positive fibers was counted across the entire cross section of each medial gastrocnemius muscle segment twice and averaged. Total fiber counting followed the methods reported elsewhere (40). Injured fibers (Con A positive) were calculated as a percentage of the total fibers in the same tissue section. Some slides were treated with Con A and antibodies against TGF-beta1 to determine the extent of colocalization in injured myofibers.

RT-PCR.   Transcript abundance was assessed on all five gastrocnemius muscle segments (L1–L5) from all 11 female SD rats. End-point and real-time RT-PCR were used in the determination of mRNA abundance as previously published (3, 16). In preliminary studies, we designed an end-point TGF-beta1 primer that failed to work in the present study for unknown reasons. Since we were working with very small samples (<2 mm in thickness), a new primer was designed for real-time PCR. Real-time PCR is more sensitive and uses less RNA (cDNA) than end-point PCR. We regret not being able to present data from both or only one PCR technique(s). We no longer have enough RNA/cDNA to rerun these samples. The TGF-beta data presented in this study are part of a larger study that required the use of the remaining RNA (cDNA).

Briefly, RNA was extracted from each muscle segment using TRI Reagent (Sigma), treated with DNase I (Ambion), and reversed transcribed (Invitrogen) with random primers (Invitrogen). TGF-beta1 (forward: 5'-ggagccactgcccatcgtctactac, reverse: 5'-ggagcgcacgatcatgttggac) TGF-beta2 (forward: 5'-ccctcctgcgacctgataagc, reverse: 5'-gcggagccttgttaatgatttg) and ribosomal 18S (r18S) (forward: 5' gccgcggtaattccagctcca, reverse: 5'-cccgcccgctcccaagatc) primers were designed from rat-specific sequences in GenBank.

For end-point PCR analysis, cDNA (1 µg) from each sample was amplified by PCR using 50 ng of each primer, 250 µM dNTPs, 1x PCR buffer, and 1 unit of Taq polymerase (Sigma) in a 50-µl final volume. r18S (Ambion) served as a housekeeping gene. Complementary DNA was amplified simultaneously for the paired control and injured muscle segments for each primer set. PCR product (18 µl) from pair segments were electrophoresed on a 1.5% agarose and stained with ethidium bromide. Images were captured and the signals quantified as optical density x band area using Kodak 1D image analysis system (Eastman Kodak). PCR signals were normalized to the r18S signal of the corresponding RT product to provide a semiquantitative estimate of gene expression.

For real-time PCR analysis, PCR was performed according to the manufacturer's protocol using Quantitect SYBRgreen PCR Reagents (Qiagen) on an iCycler iQ Multicolor Real-Time PCR Detection System (Bio-Rad). r18S was used as a reference. All samples were run in duplicate, and preliminary experiments were conducted to optimize PCR conditions. Following real-time PCR, all primer products were separated on a 3% agarose gel and stained with ethidium bromide to ensure a single product at the desired length was obtained for each primer. The comparative threshold cycle (CT) method was used to relatively quantify gene expression (26).

Validation methods were conducted over a 10-fold range of cDNA and over a 2-fold range of primer concentrations from control and injured muscle samples to confirm that the efficiency of the primers used and r18S were equal. The CT values from duplicate wells were averaged and subtracted from the corresponding averaged r18S CT value for each sample resulting in {Delta}CT. {Delta}{Delta}CT was achieved by subtracting the average control {Delta}CT value from its corresponding averaged injured {Delta}CT. The fold increase was established by calculating 2{Delta}{Delta}CT for injured vs. control samples (26).

Western blots.   Protein abundance was assessed on eight gastrocnemius muscle segments from eight different female SD rats that were chosen at random. Following sectioning and RNA isolation, the remaining tissue from each tissue segment was homogenized in lysis buffer containing protease inhibitors (41). Total protein content was determined by Bradford analysis (Bio-Rad), and bovine serum albumin was used as a standard. Protein (150 µg) was loaded on 10% polyacrylamide gels, separated by SDS-PAGE, and blotted to Hy-bond nitrocellulose membranes (Amersham). Membranes were blocked and probed with the appropriate primary (polyclonal TGF-beta1, R&D Systems; polyclonal TGF-beta2, R&D Systems) and horseradish peroxidase-conjugated secondary antibodies (Chemicon). The protein bands of interest were visualized by ECL Advance (Amersham) chemiluminescent detection kit and exposed to X-ray film. Digital records were captured with a Kodak 290 camera. The bands of interest were quantified by densitometry. The relative optical density (IOD) was corrected for variations in total protein loading using Ponceau red staining (IOD/PON) (2).

Data analysis.   A one-way ANOVA was used for the number of Con A-positive fibers in each muscle segment. A Bonferroni multiple-comparison test was used to determine differences between muscle segments. A Pearson test was used to determine if a correlation existed between myofiber injury and the various transcripts evaluated. Paired t-tests were performed to test mRNA and protein abundance in control and injured samples. Values are presented as means ± SE. Significance was accepted at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Within 48 h of strain injury, injured myofibers were identified by colocalizing Con A and laminin (Fig. 1, A and B) in focal areas (i.e., patches) of the medial gastrocnemius muscle. Injured myofibers stained for both intracellular Con A and laminin A as shown in Fig. 1A, whereas noninjured fibers stained only for laminin in the basal lamina (Fig. 1B). Although there was no difference in the number of myofibers injured per segment (~170–260 myofibers), assessment of the percentage of injured myofibers was significantly greater in the segment proximal to the calcaneal tendon (~9%, L1, Fig. 2). The midbelly (L2, L3, L4) averaged ~2.7% percent injury, whereas the segment distal to the origin (L5) averaged ~5.7% percent injury.


Figure 1
View larger version (140K):
[in this window]
[in a new window]

 
Fig. 1. Immunostained sections from gastrocnemius muscle segments (L2) 48 h after strain injury (A, C, E) and the contralateral control (B, D, F). A and B: concanavalin A (Con A) and laminin. C and D: transforming growth factor (TGF)-beta1. E and F: TGF-beta2.

 

Figure 2
View larger version (6K):
[in this window]
[in a new window]

 
Fig. 2. Percent injured myofibers 48 h after strain injury. L1 is proximal to the calcaneal tendon; L5 is distal to origin of the medial gastrocnemius. *Significantly different from L2, L3, and L4, P < 0.05.

 
Immunoreactivity for TGF-beta1 was observed 48 h after strain injury (Fig. 1C), whereas immunoreactivity for TGF-beta2 was not observed (Fig. 1E). TGF-beta1 was localized within injured myofibers or within distinct areas around injured myofibers (Fig. 1C). When double-labeling techniques were used, TGF-beta1 and Con A were colocalized in most injured myofibers (Fig. 3). Numerous small mononuclear cells within apparent myofibers in the Con A-stained samples were indicative of necrosis.


Figure 3
View larger version (82K):
[in this window]
[in a new window]

 
Fig. 3. Colocalization of Con A and TGF-beta1 in medial gastrocnemius muscle fibers 48 h after strain injury. A: Con A. B: TGF-beta1. Asterisks indicate representative examples of double-stained myofibers.

 
r18S was used as a housekeeping gene and did not change in abundance with injury (Fig. 4, A and B). Whereas both TGF-beta1 and TGF-beta2 mRNA abundance increased (27% and 17%, respectively; Fig. 4, C and D) following injury, there was no significant correlation between TGF-beta mRNA abundance and percent injury or injured myofiber number (TGF-beta1, r2 = 0.085, r2 = 0.085, respectively; TGF-beta2, r2 = 0.016, r2 = 0.005, respectively).


Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 4. Cytokine mRNA abundance assessed by end-point (B and D) or real-time PCR (A and C). A and B: ribosomal 18S (r18S). Optical density (OD) x band area is expressed in scientific notation. C: TGF-beta1. D: TGF-beta2. I, injury; C, control; Ct Cycle time. Images shown for TGF-beta2 and r18S are from the L2 and L5 injured muscle segments from different animals. The control images are from the contralateral uninjured muscles. Subscripts indicate matched pairs (1 = segment L2; 2 = segment L5). *Significant difference at P < 0.05.

 
TGF-beta1 and TGF-beta2 precursor protein levels increased (~9.9 fold and ~1.2 fold, respectively) following injury (Fig. 5, A and B). Active TGF-beta1 protein abundance did not change following injury (Fig. 5C). Only a faint band for active TGF-beta1 was detected, and no band was detected for active TGF-beta2 (Fig. 5). There was no significant correlation between TGF-beta precursor abundance and percent injury or injured myofiber number (TGF-beta1, r2 = 0.3, r2 = 0.13, respectively; TGF-beta2, r2 = 0.6, r2 = 0.007, respectively).


Figure 5
View larger version (28K):
[in this window]
[in a new window]

 
Fig. 5. TGF-beta protein abundance assessed by Western blot analysis. A: TGF-beta1 precursor protein. B: TGF-beta2 precursor protein. C: active TGF-beta1 protein. I, injury; C, control. IOD/PN, relative OD/Ponceau red staining (i.e., total protein load). Images shown for TGF-beta1 and TGF-beta2 are from the L2 and L5 muscle segments from different animals. The control images are from the contralateral uninjured muscles. Subscripts indicate matched pairs (1 = segment L2; 2 = segment L5). *Significant difference at P < 0.05.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In previous studies using muscle biopsy samples from patients with muscle diseases, TGF-beta1 was localized to the extracellular matrix in areas of thickened or fibrotic connective tissue (6, 13). These studies revealed that TGF-beta1 may play an important role in the fibrotic processes associated with progressive muscle disease. Supporting evidence came from in situ hybridization experiments that localized TGF-beta1 mRNA to areas of inflammatory cell infiltration in the mdx diaphragm (22). These experiments provided evidence that infiltrating mononucleated cells were the primary source of TGF-beta1. Since infiltrating neutrophils and macrophages are known to contain a rich source of cytokines and are known to be present in large numbers 1–3 days following injury (32, 35, 37), we evaluated muscle samples 48 h following strain injury for the presence of TGF-beta1. In the present study, TGF-beta1 was localized to areas of myofiber injury and necrosis (myofibers containing mononuclear cells) 48 h following strain injury.

Although we were not able to localize TGF-beta2 in strain-injured skeletal muscle, TGF-beta2 has been localized in denervated myofibers and myofibers with central nuclei, segmental damage, or cytoplasmic masses in both human and rat pathologic muscle (31). For example, TGF-beta2 appeared at the site of myofiber injury or necrosis within 5 h following freezing and increased in intensity through the following day, providing evidence that TGF-beta2 was derived from damaged myofibers (29). However, TGF-beta2 was not uniformly distributed but appeared to accumulate at the junction between the viable and nonviable (necrotic) portions of a myofiber when segmental damage was observed (31). Thus a transverse section through the middle of a necrotic zone could contain little or no TGF-beta2 immunoreactivity, even though the damaged myofiber expressed elevated TGF-beta2. In contrast, the random injury produced by strain injury does not contain a specific region containing a degeneration/regeneration gradient. Thus it is possible that regions enriched in TGF-beta2 were not visible in the samples examined. In addition, the amount and location of TGF-beta2 immunoreactivity may be influenced by the balance between degeneration and regeneration in both space and time (2931). For example, in freeze-injured muscles, TGF-beta2 production occurred before the inflammatory response and progressively decreased as both macrophages and TGF-beta3 accumulated (31), whereas during regeneration, TGF-beta2 immunoreactivity was strong in fusing satellite cells and newly formed myotubes but decreased as the myofiber matured. Also, even though TGF-beta2 protein was associated with myoblasts and myotubes in developing and regenerating muscles, the location of enriched TGF-beta2 protein may vary along the length of the developing myotube. In fact, TGF-beta2 was observed to be concentrated at the ends of myotubes compared with the middle (30). Even though TGF-beta2 immunoreactivity was not observed 48 h following strain injury in the present study, TGF-beta2 mRNA and precursor protein abundance were increased. Thus it is most likely that increases in TGF-beta2 protein content did occur in strain-injured skeletal muscles as previously reported (29, 31) but were undetected by the methods employed.

In addition to increasing TGF-beta2 levels following injury, TGF-beta3 was also observed in injured muscle in regions where macrophages aggregated to remove necrotic tissue and was irrespective of the age of the lesion (29). Although we did not assess TGF-beta3 in strain-injured muscles, it would appear that the various isoforms of TGF-beta may be localized to distinct regions within injured skeletal muscle depending on the stage of degeneration and/or regeneration, implying that each isoform (TGF-beta1, TGF-beta2, and TGF-beta3) may have distinctly different roles in skeletal muscle healing following injury.

In previous studies, using rodent models of muscle injury produced by eccentric contractions (5) and cardiotoxin injection (21), increased TGF-beta transcript abundance was reported 48 h following muscle injury. In this study, we evaluated both TGF-beta transcript and protein abundance 48 h following injury. As expected, TGF-beta transcript and TGF-beta precursor protein (pTGF-beta) expression were increased 48 h after injury although TGF-beta mRNA and protein abundance did not correlate with the number or percentage of pathological cells within the muscle. Although TGF-beta1 was localized to areas of muscle injury and may be produced in response to injury by muscle cells or infiltrating cells (i.e., neutrophils, macrophages), the factors regulating the activity of TGF-beta may be more important than the relative abundance of TGF-beta following muscle injury.

Interestingly, few studies distinguish between pTGF-beta (i.e., TGF-beta precursor) and active TGF-beta. TGF-beta is produced and secreted as an inactive precursor, which is unable to bind to TGF-beta receptors until the 24-kDa active TGF-beta is dissociated from the amino-terminal prosegment called the latency-associated peptide. Although activation has been postulated to occur in skeletal muscle injury, to our knowledge we are the first to detect active TGF-beta1 in skeletal muscle following strain injury. Surprisingly, there was no increase in active TGF-beta1 48 h following strain injury, and we were unable to detect active TGF-beta2 with immunoblot analysis. Although we were unable to detect an increase in active TGF-beta1 following injury, it is possible that active TGF-beta1 may have been rapidly internalized by ligand binding to chimeric TGF-beta receptors (4). It is also possible that pTGF-beta1 may not have been activated by proteolytic enzymes, such as cathepsin D, furin, or plasmin (8, 15, 27).

Although many studies presume that TGF-beta is active following injury as evident by increasing collagen transcript abundance, in vitro and in vivo studies suggest that the activation of TGF-beta may be delayed. Using human myoblasts, Tsivitse et al. (38) showed an increase in total TGF-beta1 concentrations in conditioned medium 5 h following injury with no change in active TGF-beta levels. Also, in studies involving rodent muscle laceration and strain injury models, antifibrotic agents directed against TGF-beta or TGF-beta signaling pathways, such as decorin, INF-{gamma}, and suramin, have been used (11, 12, 18, 34). When these antifibrotic agents were locally injected 1–2 wk following injury, muscle regeneration was enhanced and fibrosis was decreased. When these antifibrotic agents were injected immediately following injury, there was no effect on muscle healing (11, 12, 18, 34). Together these studies further suggest that TGF-beta activation may be delayed following pTGF-beta secretion.

Additional studies are necessary to determine if and when TGF-beta signaling pathways (Smad, JNK) (14) are activated and if specific TGF-beta receptor populations (TbetaR-I, TbetaR-II, TbetaR-III) are upregulated and/or activated following strain injury. Although the specific mechanisms involved in TGF-beta activation following muscle injury remain elusive, it appears that the activation of TGF-beta may be a critical step in determining the functional outcome of muscle repair and healing. On an initial injury, perhaps partial activation occurs, which may leave a reservoir of pTGF-beta in the extracellular matrix associated with proteoglycans such as biglycan or decorin. Over time or with repeated injury, this pTGF-beta reservoir may become activated, thus hindering muscle repair and promoting fibrosis. Although the crucial events regulating TGF-beta activity in skeletal muscle injury are unclear, it is clear that TGF-beta is increased following skeletal muscle injury and may impede muscle healing by inhibiting muscle regeneration and promoting fibrosis on activation.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by Cooperative Agreement Number R01-OH002918 from the Centers for Disease Control and Prevention to W. T. Stauber. Its contents are solely the responsibility of the authors and do not necessarily represent the official view of the National Institutes of Occupational Safety and Health, Centers for Disease Control and Prevention.


    FOOTNOTES
 

Address for reprint requests and other correspondence: W. T. Stauber, Dept. of Physiology, School of Medicine, Robert C. Byrd Health Science Center, West Virginia Univ., Morgantown, WV 26506-9229 (e-mail: wstauber{at}mix.wvu.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Allen RE, Boxhorn LK. Regulation of skeletal muscle satellite cell proliferation and differentiation by transforming growth factor-beta, insulin-like growth factor I, and fibroblast growth factor. J Cell Physiol 138: 311–315, 1989.[CrossRef][Web of Science][Medline]
  2. Alway S, Lowe D, Chen D. The effects of age and hindlimb suspension on the levels of expression of the myogenic regulatory factors MyoD and myogenin in rat fast and slow skeletal muscles. Exp Physiol 86: 509–517, 2001.[Abstract]
  3. Alway SE, Degens H, Lowe DA, Krishnamurthy G. Increased myogenic repressor Id mRNA and protein levels in hindlimb muscles of aged rats. Am J Physiol Regul Integr Comp Physiol 282: R411–R422, 2002.[Abstract/Free Full Text]
  4. Anders RA, Arline SL, Dore JJ, Leof EB. Distinct endocytic responses of heteromeric and homomeric transforming growth factor beta receptors. Mol Biol Cell 8: 2133–2143, 1997.[Abstract/Free Full Text]
  5. Barash IA, Mathew L, Ryan AF, Chen J, Lieber RL. Rapid muscle-specific gene expression changes after a single bout of eccentric contractions in the mouse. Am J Physiol Cell Physiol 286: C355–C364, 2004.[Abstract/Free Full Text]
  6. Bernasconi P, Di Blasi C, Mora M, Morandi L, Galbiati S, Confalonieri P, Cornelio F, Mantegazza R. Transforming growth factor-beta1 and fibrosis in congenital muscular dystrophies. Neuromuscul Disord 9: 28–33, 1999.[CrossRef][Web of Science][Medline]
  7. Bernasconi P, Torchiana E, Confalonieri P, Brugnoni R, Barresi R, Mora M, Cornelio F, Morandi L, Mantegazza R. Expression of transforming growth factor-beta 1 in dystrophic patient muscles correlates with fibrosis. Pathogenetic role of a fibrogenic cytokine. J Clin Invest 96: 1137–1144, 1995.[Web of Science][Medline]
  8. Bird JW, Carter JH, Triemer RE, Brooks RM, Spanier AM. Proteinases in cardiac and skeletal muscle. Fed Proc 39: 20–25, 1980.[Web of Science][Medline]
  9. Border WA, Noble NA. Transforming growth factor beta in tissue fibrosis. N Engl J Med 331: 1286–1292, 1994.[Free Full Text]
  10. Cannon JG, St. Pierre BA. Cytokines in exertion-induced skeletal muscle injury. Mol Cell Biochem 179: 159–167, 1998.[CrossRef][Web of Science][Medline]
  11. Chan YS, Li Y, Foster W, Fu FH, Huard J. The use of suramin, an antifibrotic agent, to improve muscle recovery after strain injury. Am J Sports Med 33: 43–51, 2005.[Abstract/Free Full Text]
  12. Chan YS, Li Y, Foster W, Horaguchi T, Somogyi G, Fu FH, Huard J. Antifibrotic effects of suramin in injured skeletal muscle after laceration. J Appl Physiol 95: 771–780, 2003.[Abstract/Free Full Text]
  13. Confalonieri P, Bernasconi P, Cornelio F, Mantegazza R. Transforming growth factor-beta 1 in polymyositis and dermatomyositis correlates with fibrosis but not with mononuclear cell infiltrate. J Neuropathol Exp Neurol 56: 479–484, 1997.[Web of Science][Medline]
  14. Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature 425: 577–584, 2003.[CrossRef][Medline]
  15. Dubois CM, Blanchette F, Laprise MH, Leduc R, Grondin F, Seidah NG. Evidence that furin is an authentic transforming growth factor-beta1-converting enzyme. Am J Pathol 158: 305–316, 2001.[Abstract/Free Full Text]
  16. Erdely A, Freshour G, Smith C, Engels K, Olson JL, Baylis C. Protection against puromycin aminonucleoside-induced chronic renal disease in the Wistar-Furth rat. Am J Physiol Renal Physiol 287: F81–F89, 2004.[Abstract/Free Full Text]
  17. Florini JR, Ewton DZ, Magri KA. Hormones, growth factors, and myogenic differentiation. Annu Rev Physiol 53: 201–216, 1991.[CrossRef][Web of Science][Medline]
  18. Foster W, Li Y, Usas A, Somogyi G, Huard J. Gamma interferon as an antifibrosis agent in skeletal muscle. J Orthop Res 21: 798–804, 2003.[CrossRef][Web of Science][Medline]
  19. Fritz VK, Stauber WT. Characterization of muscles injured by forced lengthening. II. Proteoglycans. Med Sci Sports Exerc 20: 354–361, 1988.
  20. Fukushima K, Badlani N, Usas A, Riano F, Fu F, Huard J. The use of an antifibrosis agent to improve muscle recovery after laceration. Am J Sports Med 29: 394–402, 2001.[Abstract/Free Full Text]
  21. Goetsch SC, Hawke TJ, Gallardo TD, Richardson JA, Garry DJ. Transcriptional profiling and regulation of the extracellular matrix during muscle regeneration. Physiol Genomics 14: 261–271, 2003.[Abstract/Free Full Text]
  22. Gosselin LE, Williams JE, Deering M, Brazeau D, Koury S, Martinez DA. Localization and early time course of TGF-beta 1 mRNA expression in dystrophic muscle. Muscle Nerve 30: 645–653, 2004.[CrossRef][Web of Science][Medline]
  23. Gulati AK, Reddi AH, Zalewski AA. Changes in the basement membrane zone components during skeletal muscle fiber degeneration and regeneration. J Cell Biol 97: 957–962, 1983.[Abstract/Free Full Text]
  24. Ignotz RA, Massague J. Transforming growth factor-beta stimulates the expression of fibronectin and collagen and their incorporation into the extracellular matrix. J Biol Chem 261: 4337–4345, 1986.[Abstract/Free Full Text]
  25. Liu D, Black BL, Derynck R. TGF-beta inhibits muscle differentiation through functional repression of myogenic transcription factors by Smad3. Genes Dev 15: 2950–2966, 2001.[Abstract/Free Full Text]
  26. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2[–{Delta}{Delta}C(T)] Method. Methods 25: 402–408, 2001.[CrossRef][Web of Science][Medline]
  27. Lyons RM, Keski-Oja J, Moses HL. Proteolytic activation of latent transforming growth factor-beta from fibroblast-conditioned medium. J Cell Biol 106: 1659–1665, 1988.[Abstract/Free Full Text]
  28. Massague J. The transforming growth factor-beta family. Annu Rev Cell Biol 6: 597–641, 1990.[CrossRef][Web of Science][Medline]
  29. McLennan IS, Koishi K. Cellular localisation of transforming growth factor-beta 2 and -beta 3 (TGF-beta2, TGF-beta3) in damaged and regenerating skeletal muscles. Dev Dyn 208: 278–289, 1997.[CrossRef][Web of Science][Medline]
  30. McLennan IS, Koishi K. The transforming growth factor-betas: multifaceted regulators of the development and maintenance of skeletal muscles, motoneurons and Schwann cells. Int J Dev Biol 46: 559–567, 2002.[Web of Science][Medline]
  31. Murakami N, McLennan IS, Nonaka I, Koishi K, Baker C, Hammond-Tooke G. Transforming growth factor-beta2 is elevated in skeletal muscle disorders. Muscle Nerve 22: 889–898, 1999.[CrossRef][Web of Science][Medline]
  32. Pizza FX, Koh TJ, McGregor SJ, Brooks SV. Muscle inflammatory cells after passive stretches, isometric contractions, and lengthening contractions. J Appl Physiol 92: 1873–1878, 2002.[Abstract/Free Full Text]
  33. Roberts AB, Sporn MB. Peptide growth factors and their receptors. In: Handbook of Experimental Pharmacology. Heidelberg, Germany: Springer-Verlag, 1990.
  34. Sato K, Li Y, Foster W, Fukushima K, Badlani N, Adachi N, Usas A, Fu FH, Huard J. Improvement of muscle healing through enhancement of muscle regeneration and prevention of fibrosis. Muscle Nerve 28: 365–372, 2003.[CrossRef][Web of Science][Medline]
  35. St Pierre BA, Tidball JG. Differential response of macrophage subpopulations to soleus muscle reloading after rat hindlimb suspension. J Appl Physiol 77: 290–297, 1994.[Abstract/Free Full Text]
  36. Stauber WT, Knack KK, Miller GR, Grimmett JG. Fibrosis and intercellular collagen connections from four weeks of muscle strains. Muscle Nerve 19: 423–430, 1996.[CrossRef][Web of Science][Medline]
  37. Tidball JG, Berchenko E, Frenette J. Macrophage invasion does not contribute to muscle membrane injury during inflammation. J Leukoc Biol 65: 492–498, 1999.[Abstract]
  38. Tsivitse SK, Mylona E, Peterson JM, Gunning WT, Pizza FX. Mechanical loading and injury induce human myotubes to release neutrophil chemoattractants. Am J Physiol Cell Physiol 288: C721–C729, 2005.[Abstract/Free Full Text]
  39. White TP, Esser KA. Satellite cell and growth factor involvement in skeletal muscle growth. Med Sci Sports Exerc 21: S158–S163, 1989.
  40. Willems ME, Stauber WT. Streptomycin and EDTA decrease the number of desmin-negative fibers following stretch injury. Muscle Nerve 32: 310–315, 2005.[CrossRef][Web of Science][Medline]
  41. Xiao S, Erdely A, Wagner L, Baylis C. Uremic levels of BUN do not cause nitric oxide deficiency in rats with normal renal function. Am J Physiol Renal Physiol 280: F996–F1000, 2001.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Appl. Physiol.Home page
B. T. Corona, C. Rouviere, S. L. Hamilton, and C. P. Ingalls
Eccentric contractions do not induce rhabdomyolysis in malignant hyperthermia susceptible mice
J Appl Physiol, November 1, 2008; 105(5): 1542 - 1553.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
B. T. Corona, C. Rouviere, S. L. Hamilton, and C. P. Ingalls
FKBP12 deficiency reduces strength deficits after eccentric contraction-induced muscle injury
J Appl Physiol, August 1, 2008; 105(2): 527 - 537.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
H. D. Kollias and J. C. McDermott
Transforming growth factor-{beta} and myostatin signaling in skeletal muscle
J Appl Physiol, March 1, 2008; 104(3): 579 - 587.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
102/2/755    most recent
01503.2005v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, C. A.
Right arrow Articles by Stauber, W. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, C. A.
Right arrow Articles by Stauber, W. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.