|
|
||||||||
1Unite Propre de Recherche de lEnseignement Superieur-Équipe dAccueil 3759 "Multidisciplinary Approach of Doping", Montpellier, France; 2Brunel University, School of Sport and Education, West London, United Kingdom; 3Laboratory of Interaction Physiology, Équipe dAccueil 701, Biology Institute, Montpellier, France; 4Laboratoire dEtude de la Physiologie de lExercice, Department of Sciences and Technology in Sports and Physical Activities, University of Evry Val dEssonne, Evry, France; 5Health and Exercise, School of Medical Sciences, The University of New South Wales, Sydney, Australia; 6Department of Human and Health Science, University of Westminster, London, United Kingdom; and 7ASPIRE, Academy for Sports Excellence, Doha, Qatar
Submitted 14 October 2005 ; accepted in final form 19 September 2006
| ABSTRACT |
|---|
|
|
|---|
)] or hypoxic conditions (
100 Torr PI
,
3,000 m) for Nor and H group, respectively, at the same relative intensity. Before and after the training period, an incremental test to exhaustion in normoxia was performed, muscle biopsy samples were taken from the vastus lateralis, and mitochondrial respiration in permeabilized fibers was measured. Peak power output (PPO) increased by 7.2% and 6.6% (P < 0.05) for Nor and H, respectively, whereas maximal O2 uptake (
O2 max) remained unchanged: 58.1 ± 0.8 vs. 61.0 ± 1.2 ml·kg1·min1 and 58.5 ± 0.7 vs. 58.3 ± 0.6 ml·kg1·min1 for Nor and H, respectively, between pretraining (W0) and posttraining (W4). Maximal ADP-stimulated mitochondrial respiration significantly increased for glutamate + malate (6.27 ± 0.37 vs. 8.51 ± 0.33 µmol O2·min1·g dry weight1) and significantly decreased for palmitate + malate (3.88 ± 0.23 vs. 2.77 ± 0.08 µmol O2·min1·g dry weight1) in the H group. In contrast, no significant differences were found for the Nor group. The findings demonstrate that 1) a 3-wk training period increased the PPO at sea level without any changes in
O2 max, and 2) a 3-wk hypoxic exercise training seems to alter the intrinsic properties of mitochondrial function, i.e., substrate preference. endurance exercise; substrate preference; hypoxic stress; aerobic adaptation; muscle biopsy
O2 max) to a greater extent than a similar sea-level training. In contrast, Hendriksen and Meeuwsen (15) concluded that 9 days after a 10-day IHT [2 h/day of cycling at 6070% of heart rate (HR) reserve in a hypobaric hypoxia at a simulated altitude of 2,500 m], performance was significantly improved in terms of maximal power output and mean and peak anaerobic power compared with similar normoxic training. Potential mechanisms underlying the observed performance enhancement include changes in a number of central (enhanced O2 transport) and peripheral (enhanced muscle oxidative capacity) responses (11, 19, 45, 48). However, there is little information available concerning the adaptations that occur in skeletal muscle when endurance training is performed entirely in hypoxia compared with normoxic condition alone.
When skeletal muscle contracts aerobically, nearly all O2 consumption and most ATP resynthesis occur in the mitochondria (37). Indeed, muscular activity demands energy that will be supplied by the selection of the preferred metabolic pathways (energy metabolism) and thus mitochondrial substrate utilization (37). This mitochondrial substrate utilization varies among muscle types and is dependant on exercise type and duration (17). It has been claimed often that mitochondrial function is impaired during exercise (12, 49). This contention is not supported by results from continuous moderate intensity, i.e., endurance exercise in which mitochondrial function is well maintained, in both animal (2, 39) and human skeletal muscle (26, 42). However, one of the main adaptations of skeletal muscle in response to endurance training is improved muscle oxidative capacity (3, 4), which results from changes in mitochondrial substrate utilization and in mitochondrial enzyme activities (18). Walsh et al. (47) observed that 6 wk of endurance training in healthy subjects increased the maximal ADP-stimulated mitochondrial respiration (Vmax) by 38%. The reduced availability of O2 under hypoxic conditions might also alter the mitochondrial functions, as it is known that hypoxia induces several physiological and cellular adaptations to maintain O2 transport to the muscles (9). To date it has not yet been shown how mitochondrial substrate utilization, respiration, and enzyme activities respond to exercise performed under hypoxic exposure. Therefore, it is possible that mitochondria are affected to a higher extent during endurance exercise performed in hypoxia compared with exercise in normoxia. Given this hypothesis, the present study was interested in comparing the effects of exercise performed in hypoxia and normoxia on the mitochondrial respiration. In particular, the present study investigated different specific metabolic pathways by using glutamate + malate and palmitate + malate as substrates. In addition, these substrates are being used as standard substrates in several other studies (28, 41, 52).
The hypothesis of this experiment was that the intrinsic properties of mitochondrial function, such as substrate preferences, are altered by exercise performed in hypoxia compared with the same relative exercise stress performed in normoxia.
| METHODS |
|---|
|
|
|---|
O2 max measured during an incremental exercise test before the experimental training period. The experiment took place in the preseason when the athletes had not reached a peak in endurance performance. Subject characteristics for each group are presented in Table 1. One athlete assigned to the Nor group did not complete the training because of illness.
|
O2 max. The interval training required the subjects to perform two sets of three repetitions of 2-min duration at an intensity of 100% PPO. Two minutes of rest was allowed between each repetition with 6 min rest between each set. The subjects trained on their own bicycle fixed on an electromagnetic resistance home trainer (Elite Travel, Milan, Italy). During each laboratory training session, the target power output, i.e., 100% PPO or the power output corresponding to 60% of
O2 max, and the HR corresponding to the target power output were continuously monitored and meticulously controlled by the same researcher. Moreover, subjects were continuously encouraged to perform at the target power output level.
Each training session was performed in either a normoxic [inspired PO2 (PI
) of 160 Torr] or hypoxic (PI
of 100 Torr, simulated altitude of
3,000 m) environment for the Nor and the H group, respectively. The average duration of the hypoxic stimulus per week during the training period was 382 min. The subjects did not perform supplementary interval training outside the two supervised interval-training sessions.
Before (pretraining = W0) and at the end (posttraining = W4) of the training period, a medical examination and determination of physical characteristics were completed (Table 1). The subjects performed an incremental exercise test to exhaustion in normoxic conditions, and an identical incremental test to exhaustion under hypoxic conditions (PI
100 Torr) on a separate visit to the laboratory was also performed by the H group. These tests were randomized for the H group. Two days after the last test, muscle biopsies were taken at rest before the training protocol. After the training protocol (W4), the muscle biopsies were taken at rest 23 days after the last training session. All tests and biopsies were performed at the end of W4, i.e., maximal 5 days after the last training session.
A physician was in attendance at all times and was responsible for the safety of the subjects during the study.
The weekly training regime that took place outside the experimental trials was controlled and documented. Last, the dietary intake of the subjects was monitored and controlled; the subjects were required to maintain consistency from week to week in their dietary intake. Both groups consumed a similar diet, i.e., the same relative proportion of fat (
30%) and carbohydrates (CHO
60%).
Environmental stimulus.
The hypoxic gas mixture was delivered continuously by a system that changes the inspired air by modifying N2 content (Altitrainer 200, SMTEC, Geneva, Switzerland) (35). This device allows the production of large quantities of a hypoxic gas mixture (up to 200 l/min), with an easily adjustable O2 fraction over a large range and with a short response time. The O2 content of the mixture is continuously displayed and can be expressed either by the equivalent altitude (
3,000 m) or the PI
(
100 Torr) taking into account the barometric pressure. Air inhaled from outside the machine is controlled with a fixed quantity of N2 coming from a bottle and then mechanically mixed before being stocked in a buffer tank of 30 liters. The first safety check is ensured by the mixers mechanical limit that cannot exceed a certain N2 fraction [fractional inspired O2 (FI
) = 9.7%]. The user inhales the mixture contained in the tank through a Hans Rudolph two-way respiratory valve. An O2 probe, a second safety check, plunged in the buffer tank, measures the PO2. This probe, with aid of a microprocessor, allows the PO2 of the inhaled mixture or the equivalent altitude to be displayed and cannot decrease to less than 66 Torr (5,500 m). If necessary, users can constantly modify the composition of the air that they breathe and thus change the simulated altitude. The respiratory mask could at all times be removed so the subjects found themselves immediately in normoxic conditions. A breath-by-breath analyzer can be easily attached to the system to measure respiratory exchange.
Performance tests.
Before and after the training period, the subjects performed an incremental test to exhaustion to determine the
O2 max (ml·kg1·min1), the PPO (W), maximal ventilation (l/min), and maximal HR (beats/min). The test began at an initial power output of 60 W for 3 min, and then the workload was increased by 30 W every minute until exhaustion. Exhaustion was reached when two of the three following criteria were obtained: 1) HR approaching an age-predicted maximum value (220 age in yr); 2) a plateau in
O2 despite an increase in exercise intensity; and 3) a respiratory exchange ratio > 1.1. Respiratory exchange was measured breath by breath and then reduced to 30-s averages.
O2 max was determined as the highest 30-s
O2 average. PPO was defined as the highest mechanical power maintained during 1 min.
In addition, only the H group performed the same test also under hypoxic conditions on a separated laboratory visit and before the start of the training protocol and biopsy (data not presented). This test was necessary to provide data to determine the workloads (100% PPO and 60% of
O2 max) under hypoxic conditions for the training sessions for the H group, so that the same relative intensity between Nor and H groups could be established to ensure an equivalent training stimulus.
The test was performed on a bicycle equipped with a SRM Road Professional powermeter (Schoberer Rad Messtechnik, Jülich, Welldorf, Germany). The saddle height on the cycle ergometer measured during the first test was kept identical. Power output and the pedaling cadence were recorded with an acquisition frequency of 1 s and then averaged over 30 s. The calibration procedure and technical aspects concerning the SRM crank system have been described in detail by Jones and Passfield (23). The SRM Road Professional power meter that has four strain gauges was shown to have a high accuracy in power measurement. The 95% limit of agreement is 2.1 W, which is equivalent to 1.8% (23).
Training outside experimental design. The training completed outside the experimental design was recorded daily by using a computerized training diary during the 3 wk of the training period. The type of activity, i.e., cycling, swimming, running, etc., and the intensity were recorded with this training diary. The training intensity was divided into five intensity levels (30). All training sessions outside the protocol were individually timed, and each exercise was categorized according to the five intensity levels. The performed training duration was multiplied by its corresponding multiplying factor, i.e., 2, 4, 6, 10, and 16, respectively, and the sum was then divided by the overall duration of the session to calculate the average intensity of each training session. The recorded parameters were the number and average intensity of the sessions, calculated according to Mujika et al. (30) as it was not sensible to compare hourly volume as the subjects performed exercise training in different modes (swimming, running).
Physiological measurements.
Pre (W0)- and posttraining (W4) gas exchange was measured by a K4b2 (Cosmed, Rome, Italy). The K4b2 configuration was modified to calculate the ventilatory variables with the accurate FI
rather than with the default version. The aforementioned physiological variables were measured, breath by breath, and averaged every 30 s. Before each test, the system was calibrated using ambient air, whose partial O2 composition was assumed to be 20.93%, and a gas of known CO2 (5%) and O2 (16%) concentration. The calibration of the turbine flowmeter of the K4b2 was performed with a 3-liter syringe (Quinton Instruments, Seattle, WA).
During the different tests and training sessions, the HR was constantly recorded by the means of a HR monitor (S810, Polar, Kempele, Finland) integrated to the Cosmed system.
Muscle biopsy. Muscle samples were obtained from the vastus lateralis using the percutaneous needle biopsy technique after administration of local anesthesia (xylocaine) as previously described and perfomed in our laboratory (41). The biopsies were taken by the same researcher from the same site, i.e., in the middle of the line between spina iliaca anterior superior and the upper outer corner of the patella at a depth of 1.52.0 cm from the fascia in all the subjects.
The muscle samples were divided into two portions with one portion immediately frozen in liquid nitrogen and stored at 80°C until enzymatic analysis. The second portion was used for in situ respiration studies and was immediately placed in an ice-cold relaxing solution [at ionic strength 160 (potassium methanesulfonate), pH 7.1] containing (in mM) 10 EGTA-calcium buffer (free Ca2+ concentration 100 nmol/l), 20 imidazole, 3 KH2PO4, 1 MgCl2, 20 taurine, 0.5 DTT, 5 MgATP, and 15 PCr.
The muscle fiber bundles were separated with sharp-ended needles and were incubated in 1 ml of the relaxing solution (4°C) containing 50 µg/ml saponin for 30 min with continuous agitation. To completely remove the saponin, the incubated muscle fibers were washed with continuous stirring in relaxing solution for 10 min (4°C); to remove free ATP, they were then washed with oxygraph solution for 2 x 5 min (4°C), which was of the same composition as the relaxing solution except that MgATP and PCr were replaced (in mM) by 2 malate, 3 phosphate, and 2 fatty acid-free BSA (pH 7.1). After being washed, the fibers were stored in oxygraph solution for immediate determination of mitochondrial respiration activity.
The skinned fiber preparations met the necessary criteria defined by Saks et al. (36). All fiber preparations and respiratory measurements were performed under identical conditions and by the same researcher for the Nor and H group.
Unfortunately, for technical reasons, the posttraining biopsy in two subjects of the H group was not possible; therefore only eight subjects are included in the biopsy-derived measurements.
Mitochondrial respiration studies. The respiratory parameters of the total mitochondrial population were studied in situ as previously described (28, 44) by using a Clark electrode (Strathkelvin Instruments, Glasgow, United Kingdom). These measurements are extensively being done in our laboratory (41). Measurements were carried out at 30°C with continuous agitation in 3 ml of oxygraph solution with either glutamate (5 mM) + malate, or palmitate (40 mM) + malate as respiratory substrates. This continuous agitation was necessary to ensure stability of the preparation and reliable comparison of the data (36). Moreover, the O2 consumption values were corrected for instrumental and chemical background O2 consumption. Vmax above basal O2 consumption (V0), i.e., oxygen consumption in the absence of nucleotides, was measured by addition of ADP (2,000 µM). At the end of measurement, we used the cytochrome c test to investigate the state of the outer mitochondrial membrane (36). After the respiratory measurements, the muscle fiber bundles were removed, dried overnight, and weighed the next day. Respiration rates were expressed in micromoles of O2 per minute per gram of dry weight.
Mean V0 was determined and Vmax for each substrate was calculated by using a nonlinear monoexponential fitting of the Michaelis-Menten equation with DataFit 6.0 software (Oakdale Engineering). The acceptor control ratio (ACR) was calculated as Vmax/V0, representing the degree of coupling between oxidation and phosphorylation. The ratio of maximal palmitate and glutamate oxidation (Vmax Palm/Vmax Glut) is calculated, with Vmax Palm and Vmax Glut each expressed in micromoles O2 per minute per gram of dry weight.
The palmitate measures for the H and Nor groups were determined in two independent series of experiments.
Citrate synthase and hydroxyacyl-CoA-dehydrogenase activity. Homogenates for citrate synthase (CS) and hydroxyacyl-CoA-dehydrogenase (HADH) activity were prepared in buffer containing (in mM) 210 sucrose, 2 EGTA, 40 NaCl, 30 HEPES, 5 EDTA, and 2 phenylmethylsulfonyl fluoride (pH 7.4) and stored at 80°C. CS and HADH activities were assayed by a spectrophotometric method. Changes in absorbance were recorded over 3 min at 412 nm at 25°C for CS (38) and over 10 min at 340 nm at 30°C for HADH analyses (50).
Real-time RT-PCR for CS and HADH mRNA.
Total RNA was isolated by using commercially available reagents [FastRNA Kit-Green (BIO 101), Vista, CA] and then quantified spectrophotometrically at 260 nm. First-strand cDNA was generated from 1 µg RNA by using AMV RT (Promega, Madison, WI). The cDNA was then stored at 20°C until further analysis. cDNA primers and probes were designed by using Primer Express software package version 1.0 (Applied Biosystems) from gene sequences obtained from GenBank (CS, HADH). The cDNA samples were prepared for analysis by using Brilliant QPCR kit (Stratagene) with SYBR Green I dye and forward/reverse primers (3 µM). The forward primer (5'3') for CS and HADH is GTGCCCATACCAGCCACTTG and TGGCTTCCCGCCTTGTC, respectively, and the reverse primer (5'3') is CTGCCAGCCCGTTCATG and TTGAGCCGGTCCACTATCTTC for CS and HADH, respectively. Samples were run for 40 cycles in a total volume of 20 µl. The linearity of the primers was also confirmed with a serial of dilution of cDNA. Real-time PCR was performed using the ABI PRISM 5700 sequence detection system (Applied Biosystems). Samples for each gene were run in duplicate on each plate to control for amplification efficiency. Fluorescent emission data were captured and mRNA levels were quantified for each gene using the critical threshold (CT) value. The relative expression of the gene of interest is calculated by using the expression 2
CT and normalized to baseline values and standardized to an unchanged internal control, then expressed as fold change.
Statistical analysis. All values are reported as means ± SE. After analysis of normality and homogeneity of variance, the effects of the two training conditions on each variable were compared by using a two-way (training group x time) ANOVA with repeated measures on the second factor. The reliability of the CS and HADH mRNA measurements and the interassay variability of Vmax Palm and Vmax Glut were also assessed as the typical (standard) error of measurement expressed as a coefficient of variation (CV; percentage of the mean) between analyses. Significant effects were subsequently analyzed by using the Student-Newman-Keuls post hoc test. All analyses were completed by using SigmaStat 2.3 (Jandel, San Rafael, CA), and the statistical power was calculated for each analysis. Statistical significance was accepted at P < 0.05.
| RESULTS |
|---|
|
|
|---|
|
|
Incremental test to exhaustion.
There were no significant differences in the initial PPO and
O2 max between the groups. The physiological variables obtained from the incremental test are presented in Table 4. The PPO increased with training (P < 0.001, statistical power = 0.969) by 7.2% and 6.6% for Nor and H, respectively.
|
|
|
CS and HADH analyses. There were no significant differences between or within both groups for CS and HADH measurements. The CS values were 18.9 ± 0.6 vs. 19.9 ± 0.5 µmol·min1·mg protein1 at W0 and 20.4 ± 0.6 vs. 19.2 ± 0.4 µmol·min1·mg protein1 at W4 for the Nor vs. H group, respectively. The HADH values were 1.27 ± 0.06 vs. 1.10 ± 0.09 µmol·min1·mg protein1 at W0 and 0.88 ± 0.07 vs. 1.29 ± 0.05 µmol·min1·mg protein1 at W4 for the Nor vs. H group, respectively. There was no significant difference in the fold change in CS mRNA between the H and Nor groups (1.6 ± 0.3 vs. 1.4 ± 0.1). There was also no significant fold difference in HADH mRNA before and after the training between the two groups (4.2 ± 0.9 vs. 2.8 ± 0.3). CV was 1.31% and 1.65% for the duplicated analyses for CS and HADH, respectively.
| DISCUSSION |
|---|
|
|
|---|
O2 max, and 2) hypoxic exercise training seems to induce qualitative changes of skeletal muscle mitochondrial respiration without a change in enzymatic activity at the protein and gene level. Mitochondrial respiration. To our knowledge, the effect of a hypoxic exercise-training period on mitochondrial respiration in humans has not yet been studied. In the present study, the maximal muscle oxidative capacity was measured in situ with different types of substrates. Several studies used glutamate + malate as substrate to investigate maximal oxidative capacity (28, 41, 52). In addition, palmitate + malate was also tested to investigate the different specific metabolic pathways. The biopsies were taken from the vastus lateralis because this muscle is highly activated during cycling. Muscle oxidative capacity has been shown to be significantly improved by endurance training (3, 4, 46). However, the present study showed no alteration in mitochondrial respiration, measured in situ, after a normal, normoxic exercise-training period. This result is in agreement with the study of Ponsot et al. (32), who observed no changes in mitochondrial function in male distance runners after 6 wk of two training sessions per week of treadmill running at the second ventilatory threshold (VT2) at sea level. In contrast, Walsh et al. (46) found an increase in maximal mitochondrial respiration after 6 wk of endurance cycle training. However, the study was done in untrained subjects. Zoll et al. (51) found that 8 wk of voluntary wheel running increased the mitochondrial oxidative capacity; however, this study was done on female Wistar rats. The present study is to our knowledge the first study to investigate the effect of endurance training in trained athletes.
The absence of changes in the Nor group in the present study might be explained by the fact that the subjects are trained endurance athletes and thus have already a high initial level of muscle oxidative capacity. Another explanation could be that the training stimulus was not high enough to evoke functional mitochondrial adaptations.
Meanwhile, the hypoxic exercise-training period, to the contrary, seems to alter the mitochondrial respiration. These results are similar to those of the IHT group in the study of Ponsot et al. (32), who observed that the IHT group, who performed 6 wk of treadmill running at VT2 at FI
of 14.5%, improved mitochondrial function of the vastus lateralis, whereas as mentioned above no differences were observed for the normoxic control group.
The changes in mitochondrial respiration occur only in the H group; therefore, they can be attributed to the hypoxic exposure. This finding may be explained by a decreased mechanical efficiency, i.e., an altered recruitment pattern of fibers and muscles during hypoxic exercise. Unfortunately, the present study was not designed to investigate this. Because of the lack of oxygen during hypoxic exercise, the intrinsic properties of mitochondrial function, i.e., the substrate preferences, might be altered. Indeed, IHT increased carbohydrate utilization and seems to decrease fat oxidation. These findings are in accordance with Roberts et al. (33), who observed, by using indirect blood parameter measurements to investigate substrate preference, a decreased reliance on free fatty acids and an increase in glucose dependence after a chronic (21 day) altitude exposure (4,300 m) in healthy men. However, no significant effect was found after an acute (4 h) exposure to altitude (4,300 m) (33). Moreover, Roberts et al. (34) concluded that altitude exposure (3 wk at 4,300 m) increased glucose utilization both during rest and at exercise. The observed shift in substrate preferences, i.e., an increased glucose and decreased lipid utilization, under intermittent hypoxic conditions may be more efficient as glucose is the most oxygen-efficient substrate for energy metabolism (33). Therefore, the hypoxic stimulus seems to override the exercise training stimulus.
Indeed, it is well known that endurance training increases the subjects capacity to oxidize fat during exercise (16). Dyck et al. (5) found that palmitate oxidation increased in both untrained and trained rat soleus muscle after an 8-wk endurance training protocol. It is generally accepted that a hypoxic training environment induces several physiological and cellular adaptations to maintain O2 transport to satisfy tissue ATP demand. Moreover, the composition of skeletal muscle isoforms is modified by hypoxia in the sense of an increase in the fast-type isoforms. Indeed, several studies found that rats, exposed to hypoxia, presented a shift in favor of glycolytic-oxidative fibers compared with normoxic control rats (20, 21). Tonkonogi et al. (42) showed that fiber type-specific control of mitochondrial respiration is also present in human skeletal muscle mitochondria. Hypoxia alone affects the structural and biochemical properties of skeletal muscle by inducing a change in the profile of type I (oxidative) to type II (glycolytic) fibers (20, 21), which will affect the changes in substrate preference, i.e., an increase in glutamate and a decrease in palmitate utilization (33, 34), which is in agreement with the suggested shift in muscle fiber type. Unfortunately, we were not able to determine changes in muscle fiber type due to the quantity of muscle collected from that used for the mitochondrial respiration studies. However, fiber type does not change with acute training when quantified by standard histochemistry.
The fact that the ACR values for glutamate and palmitate did not change in both groups over time might suggest that the electron transport to phosphorylation coupling did not increase (52). Therefore, this electron transport may have reached already its maximal level in these trained endurance athletes.
However, the preprotocol difference in Vmax for palmitate + malate does limit the present conclusion on the effects of hypoxia on substrate preferences. Therefore, some caution has to be taken when discussing the observed decrease in palmitate utilization. As can be noticed, the initial level of palmitate oxidation is significantly higher in the H group compared with the Nor group. All measurements were done under identical conditions by the same researcher, and technical bias or equipment failure can be excluded. A possible explanation could be differences in dietary intake of the subjects. However, the diet was shown to be similar between subjects, i.e., high CHO. Another explanation can be muscle fiber differentiation as it is known that isolated mitochondria from fibers of type I are different in enzymes and substrate utilization compared with fibers of type II (22). Indeed, several studies observed that substrates differ in their concentration between different types of muscle fibers, with higher glycogen concentration in type II and higher triglyceride concentration for type I fibers (8). However, Erzen et al. (7) found no significant differences in terms of percentage and surface area in muscle fiber types I, IIa, IIb, and IIc from distinct symmetrical sites of the left and right of the vastus lateralis in 10 young health male subjects. Pernus and Erzen (31) analyzed a total of 106 fascicles at six predetermined areas of the vastus lateralis biopsy samples in healthy men (1840 yr) and concluded that a consistent arrangement of fiber types within the fascicles was obtained, regardless of fascicle size, fiber type proportion, biopsy site, and subject. The main characteristic of fiber distribution was a uniform distribution of IIa fibers in all layers in a vastus lateralis fascicle.
On the other hand, Elder et al. (6), using a more extensive sampling technique, demonstrated that multiple samples need to be collected from quadriceps muscle to decrease the between-site SD. Indeed, McGuigan et al. (27) suggested that sampling of 150200 type I and IIA fibers from random blocks is required to provide an accurate reflection of fiber cross-sectional area. Therefore, fiber type differences in the sampling for the fascicles for the respiration measured may still present a source of bias for the preexisting differences between H and Nor group.
Unfortunately, the present study did not analyze the fiber type distribution and therefore cannot totally exclude the possibility of muscle fiber differentiation. Therefore caution has to be taken when interpreting the results.
Mitochondrial enzyme activity. One of the main adaptations of skeletal muscle in response to endurance training is improved muscle oxidative capacity (3, 4), which results from changes in mitochondrial substrate utilization but also from changes in mitochondrial enzyme activities (18). However, the present study did not observe any changes in CS and HADH or in CS mRNA and HADH mRNA. According to the literature, several studies (14, 19) suggest that hypoxia per se is not a stimulus for increased mitochondrial oxidative enzyme activity (14, 25). Mizuno et al. (29) demonstrated a significant decrease in CS activity and in HADH in the gastrocnemius muscle; however, in the triceps brachii muscle the enzyme activities were maintained on return to sea level after a 2-wk training period at 2,1002,700 m. The performed training consisted mainly of cross-country skiing, which involved more arm and less leg muscles. In contrast, Terrados et al. (40) found a significantly greater increase in CS activity in leg musculature trained in hypobaric hypoxia (34 sessions of 30 min at 2,300 m/wk during 4 wk) compared with normoxic training. Also a more pronounced increase, although not significantly different, was observed in HADH (40). Thus there are equivocal findings on the effect of hypoxia per se or combined with exercise on mitochondrial enzyme activity. It seems that the hypoxic stimulus of 382 min/wk at 3,000 m during 3 wk in the present study was not enough to evoke any changes in the mitochondrial oxidative enzyme activities while this stimulus is enough to evoke changes in the overall mitochondrial substrate utilization. Moreover, changes in muscle enzyme activities can be an indication of training- and/or hypoxic-induced changes in mitochondrial volume and density (41); however, the fact that no changes in enzyme activities were observed suggests that there were no changes in mitochondrial volume and density in both groups. Moreover, the vastus lateralis of the subjects could have reached the maximal level in mitochondria. This result is in contrast with the studies of Geiser et al. (11) and Vogt et al. (45), where an increase in mitochondrial content after hypoxic training and exposure was found. Under hypoxic conditions the protein synthesis seems to be compromised (13).
Endurance performance. The present study showed that five sessions per week during 3 wk of exercise training significantly improved normoxic PPO. However, performing such training under hypoxic or normoxic conditions did not further enhance these improvements. Therefore, the primary goal of hypoxic training, i.e., to enhance sea-level performance more than normoxic training, is not validated in the present study.
The observed results are in accordance with Truijens et al. (43), who found that a 5-wk training program with two high-intensity training sessions in a flume per week in well-trained swimmers did improve sea-level performance, i.e., 100- and 400-m freestyle swim and even
O2 max; however, no additional improvement was induced by performing this training under hypoxia (FI
= 15.3%). Similarly, Roels et al. (35) concluded that IHT of two high-intensity cycling sessions per week (10090% relative PPO, identical to the present high-intensity sessions) during 7 wk at a simulated altitude of 3,000 m in well-trained cyclists and triathletes did not improve performance, i.e., PPO and 10-min cycle time trial or
O2 max, to a greater extent than a similar sea-level training. In contrast, Julian et al. (24) observed that 4 wk of 5:5 min hypoxia-to-normoxia ratio for 70 min at 10% FI
for 5 days/wk in well-trained runners did not alter the 3-km time-trial performance or
O2 max. Also, Hendriksen and Meeuwsen (15) concluded that 9 days after a 10-day IHT (2 h/day of cycling at 6070% of HR reserve in a hypobaric hypoxia at a simulated altitude of 2,500 m), performance was significantly improved in terms of maximal power output and mean and peak anaerobic power compared with similar normoxic training. Thus the efficacy of IHT in terms of performance improvement remains controversial.
This study suggests that 3 wk with two sessions of interval training and three steady work-training sessions are sufficient to obtain significant improvements in sea-level endurance performance; however, no improvements were found in
O2 max. Meanwhile, it is well known that small, statistically nonsignificant improvements can result in a significant increase in endurance performance (10) and that for trained athletes endurance performance may be independent of
O2 max and that other submaximal variables may influence performance to a greater extent (1).
In terms of practical application of this IHT protocol for endurance athletes, the observed differences in mitochondrial oxidation could have an effect on submaximal parameters of endurance performance, which may influence performance (1). The subjects in this study were trained athletes, who have already a high initial level of oxidative capacity; therefore it might be that the IHT stimulus needs to be stronger, i.e., a higher level of simulated altitude or longer duration, to induce an observable impact of the differences in mitochondrial oxidation on maximal parameters of endurance performance. Further investigation is necessary to address this issue.
In addition, the fact that mitochondrial oxidative capacity increased in the H group without any improvement in whole body
O2 max is in accordance with the consensus that
O2 max is limited more by cardiac output and not by peripheral changes in skeletal muscle.
The present results suggest that qualitative rather than quantitative changes in mitochondrial function of trained athletes with an already well-developed mitochondrial oxidative capacity can be obtained after a 3-wk intermittent hypoxic training program. These qualitative changes might increase the aerobic performance by ameliorating the integration of energy demand to utilization (32).
In summary, the present study has shown that 3 wk of endurance training performed in hypoxia seems to alter substrate preference as measured by mitochondrial respiration compared with endurance training performed in normal environmental conditions but does not alter normoxic
O2 max or PPO more than identical training in normoxia.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. N. Ainslie, M. Hamlin, J. Hellemans, P. Rasmussen, and S. Ogoh Cerebral hypoperfusion during hypoxic exercise following two different hypoxic exposures: independence from changes in dynamic autoregulation and reactivity Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2008; 295(5): R1613 - R1622. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |