Journal of Applied Physiology Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Appl Physiol 101: 385-391, 2006. First published April 13, 2006; doi:10.1152/japplphysiol.01486.2005
8750-7587/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
101/2/385    most recent
01486.2005v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zoll, J.
Right arrow Articles by Geny, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zoll, J.
Right arrow Articles by Geny, B.

ACE inhibition prevents myocardial infarction-induced skeletal muscle mitochondrial dysfunction

Joffrey Zoll,1,* Laurent Monassier,2,* Anne Garnier,3 Benoit N'Guessan,1 Bertrand Mettauer,1 Vladimir Veksler,3 François Piquard,1 Renée Ventura-Clapier,3 and Bernard Geny1

1Service de Physiologie et d'Explorations Fonctionnelles, EA 3072 and 2Laboratoire de Neurobiologie et de Pharmacologie Cardiovasculaire, INSERM U715, Hôpitaux Universitaires de Strasbourg, Faculté de Médecine, Strasbourg; and 3Cardiologie Cellulaire et Moléculaire U769 INSERM, Faculté de Pharmacie, Université Paris-Sud, Châtenay-Malabry, France

Submitted 28 November 2005 ; accepted in final form 31 March 2006


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Heart failure is associated with alterations in cardiac and skeletal muscle energy metabolism resulting in a generalized myopathy. We investigated the molecular and cellular effects of angiotensin-converting enzyme inhibition (ACEi) on skeletal muscle metabolism in infarcted animals. Myocardial infarction (MI) was obtained by left descending coronary artery ligation. Sham, MI, and MI-treated rats (perindopril, 2 mg·kg–1·day–1 given 7 days after MI) were studied 1 and 4 mo after surgery. Oxygen consumption of white gastrocnemius (Gas) muscle was studied in saponin-permeabilized fibers, using the main substrates of mitochondrial respiration. mRNA expression of nuclear factors (PGC-1{alpha}, NRF-2{alpha}, and mtTFA), involved in the transcription of mitochondrial proteins, and of MCIP1, a marker of calcineurin activation, were also determined. Echocardiographic left ventricular fractional shortening was reduced in both MI and perindopril group after 1 and 4 mo, whereas systemic blood pressure was reduced by 16% only in the MI group after 4 mo. The capacity of Gas to oxidize glutamate-malate, glycerol-triphosphate, or pyruvate (–30%, P < 0.01; –32%, P < 0.05; –33%, P < 0.01, respectively), was greatly decreased. Furthermore, PGC-1{alpha} (–54%), NRF-2{alpha} (–45%), and MCIP1 (–84%) gene expression were significantly downregulated. ACEi improved survival, left ventricular function, and blood pressure. Perindopril protected also totally the Gas mitochondrial function and preserved the mRNAs concentration of the mitochondrial transcriptional factors. Moreover, PGC-1{alpha} correlated with Gas oxidative capacity (r = 0.48), mitochondrial cytochrome-c oxidase (r = 0.65), citrate synthase (r = 0.45) activities, and MCIP1 expression (r = 0.44). Thus ACEi totally prevented MI-induced alterations of skeletal muscle mitochondrial function and protein expression, halting the development of this metabolic myopathy.

rehabilitation; mitochondria; angiotensin-converting enzyme inhibition


CHRONIC HEART FAILURE (CHF) is characterized by impaired cardiac function, muscular fatigue, and reduced exercise tolerance. Reduction of exercise capacities involves not only the cardiovascular system but also the skeletal muscles themselves. Indeed, clinical and animal studies described muscular atrophy associated with fiber-type phenotype shift toward a more fast-twitch glycolytic phenotype during heart failure (14, 23, 24, 26). Furthermore, impairments of mitochondrial function were observed in the heart and fast and slow skeletal muscles (3, 4) and were attributed to the downregulation of transcriptional coactivators and transcription factors implicated in mitochondrial biogenesis (PGC-1{alpha}, NRF-2{alpha}, and Tfam; Ref. 11).

The generalized character of this metabolic myopathy suggests that humoral systemic factors could be involved (27). The renin-angiotensin-aldosterone system (RAAS) is well known to be implicated in the development of peripheral abnormalities. Its key effector peptide angiotensin II, a strong vasoconstrictor augmenting vascular tone, increases left ventricular (LV) afterload, reduces cardiac and muscle perfusions, and modulates angiogenesis. Long-term angiotensin-converting enzyme inhibition (ACEi) largely improves cardiac function and remodeling in patients with heart failure and reduces systemic and local neurohormonal activations. ACEi enhances blood flow to skeletal muscle during exercise, probably in relation to peripheral (vascular) mechanisms and improved oxygen utilization (5). Accordingly, ACEi has been shown to protect cardiac muscle phenotype (12, 20), to prevent vascular alterations (17, 22), and to restore the abnormal myosin heavy chain (MHC) profile in skeletal muscle (30), in the model of myocardial infarction (MI)-induced CHF. On the other hand, ACEi failed to restore skeletal muscle's oxidative capacity in heart failure rats secondary to aortic stenosis (16). In opposition to data obtained previously in patients without ACEi, the skeletal muscle mitochondrial function was not impaired in patients under ACEi presenting with heart failure secondary to dilated idiopathic cardiomyopathy and ischemic heart disease (60 and 27% of the patients, respectively) in one study (15), and ischemic heart disease for 57% and dilated cardiomyopathy for 36% in another study (28). Moreover, we recently showed that preservation of skeletal muscle mitochondrial function in heart failure patients is accompanied by preserved markers and transcription factors of mitochondrial biogenesis and by calcineurin activation (9). We thus studied mRNAs coding for transcriptional coactivators and transcription factors implicated in mitochondrial biogenesis [PGC-1{alpha}, NRF-2{alpha}, and Tfam (11)], and MCIP1, a marker of calcineurin activation (31).

In view of these findings, we hypothesized that ACEi treatment could be involved in the protection of mitochondrial function through commensurate adjustments in the transcript level of mitochondrial transcription factors. The model of rat myocardial infarction was used because it is a clinically relevant model and because (in contrary to aortic stenosis) it allows full efficacy of ACEi.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Animals.   Male Wistar rats weighing 250 g were housed at 22 ± 2°C, on a 12:12-h photoperiod, and were provided with food and water ad libitum. This investigation was carried out in accordance with the Guide for the Care and Use of Laboratory Animals (National Institutes of Health Publication no. 85-23, revised 1996).

Production of the model.   Under pentobarbital anesthesia (60 mg/kg), animals were intubated and artificially ventilated with room air (Ugo Basile, model 7025), and their proximal left coronary artery was ligated after left thoracotomy. Control rats were sham operated without coronary ligation.

Seven days after surgery, quantification of the MI size was performed in pentobarbital-anesthetized animals, breathing spontaneously, by two-dimensional echocardiography (Sonos 5500, Philips Ultrasound) with a 12-MHz phased array transducer (S12).

Perindopril treatment.   After echocardiography, rats were divided into three groups and were analyzed 1 or 4 mo later: sham-operated untreated rats (Sham, n = 9 at 1 mo and n = 8 at 4 mo), MI untreated rats (MI, n = 9 at 1 mo and n = 8 out of 13 at 4 mo), and MI treated with perindopril (PE) (2 mg·kg–1·day–1 in the drinking water, MI-PE, n = 9 at 1 mo and n = 8 out of 10 at 4 mo). The treatment was administered 7 days/wk for 1 or 4 mo, the dose of PE being similar to that previously used (16). We did not study sham-operated rats treated with PE because ACEi did not modify healthy skeletal muscle mitochondrial function (1).

Cardiovascular measurements.   Heart rate and systemic blood pressure were recorded 1 or 4 mo after surgery by the tail-cuff technique (LE5002 storage pressure meter, Letica) in conscious rats; all data were stored in digital format (Biopac).

LV function was obtained by echocardiography 1 or 4 mo after surgery. Fractional shortening was calculated as FS = (LVEDD – LVESD/LVEDD) x 100, where LVEDD and LVDSD are LV internal diameters in end-diastole and end-systole, respectively. The left ventricle score of akinesia was calculated as follows: parasternal long and short axis views were divided into four segments, and a score of 1 was given for each akinetic or dyskinetic segment or 0 if the displacement was normal. If an aneurysm was observed on a view, a score of 1 was added to this section. All measurements were obtained on at least three beats, according to the guidelines of the American Society of Echography. Only rats exhibiting significant myocardial infarction as inferred from a left ventricle score of akinesia higher than 3 were included in the study.

Tissue processing of skeletal muscle.   The glycolytic superficial gastrocnemius muscle (Gas) was selected because of its higher sensitivity to heart failure (8) and because of its metabolic characteristics close to those of deconditioned human skeletal muscle (18, 32, 33).

Gas muscles were excised and cleaned of adipose and connective tissues. Right muscle was immediately used for the study of respiratory parameters and left muscle was quickly frozen at –80°C for subsequent analysis.

Functional properties of mitochondria.   The respiratory parameters of the total mitochondrial population were studied in situ in saponin-skinned fibers by a method described earlier (3). Briefly, respiratory rates were determined by using a Clark electrode (Strathkelvin Instruments) in an oxygraphic cell at 22°C with continuous stirring. Thin muscle fibers were isolated in the skinning (S) solution containing (in mmol/l): 2.77 CaK2EGTA, 7.23 K2EGTA, 6.56 MgCl2, 5.7 Na2ATP, 15 phosphocreatine (PCr), 20 taurine, 0.5 DTT, 50 K methane-sulfonate, 20 imidazole (pH 7.1) and incubated for 30 min in solution S with 50 µg/ml saponin. Permeabilized fibers were transferred to respiration (R) solution (composition as S solution, but containing 3 mmol/l K2HPO4 instead of PCr and ATP) for 10 min to wash out adenine nucleotides and PCr. All steps were carried out at 4°C with continuous stirring. Respiration rates of 10–15 mg of skinned fibers were measured at 22°C in 3 ml of solution R that contained 2 mg/ml bovine serum albumin with or without substrates. After the experiment, fiber bundles were dried and weighed. Rates of respiration are given in micromoles O2 per minute per gram dry weight. Maximal oxidative capacities were determined in the presence of ADP (2 mM), with each mitochondrial substrate added to the preparation (18, 19). Substrates used were 1) glycerol-3-phosphate (G3P, 3 mM), which diffuses to the intermembrane space and activates the mitochondrial G3P dehydrogenase, providing FADH2 directly to the mitochondrial respiratory chain; 2) glutamate (5 mM) + malate (2 mM), which activate the Krebs cycle enzyme malate dehydrogenase providing NADH to the respiratory chain; 3) pyruvate 500 µM + malate 2 mM, which activate the pyruvate dehydrogenase complex localized in the mitochondrial matrix; and 4) palmitoyl carnitine (135 µM) + malate (2 mM), which is transferred into the matrix by the inner membrane-localized carnitine translocase and carnitine palmitoyl transferase II and then activates the beta-oxidation. Under these conditions, ADP, inorganic phosphate, and O2 were present at saturating concentration in the oxygraphic chamber.

The coupling of phosphorylation to oxidation was determined by calculating the acceptor control ratio (ACR) as the ratio between ADP-stimulated respiration over basal respiration (without ADP) with glutamate and malate as substrate. Respiration rates were expressed as micromoles O2 per minute per gram dry weight.

Enzyme analysis.   Frozen tissue samples were weighed, homogenized into ice-cold buffer (30 mg/ml) containing (in mM) 5 HEPES, 1 EGTA, 5 MgCl2, 1 DTT, and Triton X-100 (0.1%), pH 8.7, and incubated for 60 min at 0°C to ensure complete enzyme extraction. Citrate synthase and cytochrome-c oxidase were assessed by standard spectrophotometric methods as previously described (4).

Real-time quantitative RT-PCR analysis.   Total muscle RNA was isolated from frozen tissue samples (10–20 mg) using the Trizol reagent technique. Oligo-dT first-strand cDNA was synthesized from 2 µg total RNA using Superscript II reverse transcriptase (InVitrogen). Real-time PCR was performed using the SYBRgreen technology on a LightCycler rapid thermal cycler (Roche Diagnostics) as previously described (8). The target genes were the peroxisome proliferator activated receptor gamma coactivator 1{alpha} (PGC-1{alpha}, NM_031347 [GenBank] , forward primer: CACCAAACCCACAGAGAACAG, reverse primer: GCAGTTCCAGAGAGTTCCACA), the nuclear respiratory factor 2 DNA-binding alpha subunit (NRF-2{alpha}, XM_344002 [GenBank] , forward primer: CACCACACTCAACATTTCGG, reverse primer: CCTTGGGGACCTTTGAACTT), the mitochondrial transcription factor A (mtTFA, NM_031326 [GenBank] , forward primer: GAAAGCACAAATCAAGAGGAG, reverse primer: CTGCTTTTCATCATGAGACAG) and the myocyte-enriched calcineurin interacting protein 1 (MCIP1, NM_004414 [GenBank] , forward primer GCTCCCTGATTGCCTGTGT, reverse primer GGGTCGCATCTTCCACTTG). The glucocerebrosidase (housekeeping gene, GCB, NM_000157 [GenBank] , forward primer: GCACAACTTCAGCCTCCCAGA, reverse primer: CTTCCCATTCACCGCTCCATT) was used for normalization. Values of each gene were normalized to GCB mRNA content to compensate for variation in input RNA amounts and efficiency of reverse transcription and corrected for the amount of RNA relative to muscle weight (8).

Statistical analysis.   Values are expressed as means ± SE. Determination of statistical significance of MI-PE treatment was accomplished by using a two-way ANOVA. When appropriate, differences between groups were tested with a Newman-Keuls post hoc test. Mortality rates were compared using the {chi}2 test. Statistical significance was accepted at P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
Survival.   None of the sham-operated animals died during the study. None of the MI rats died by 1 mo postprocedure. MI rats showed significant mortality by 4 mo, with a mortality significantly higher in untreated group (5 of 13 rats died, 40%) compared with PE-treated group (2 of 10 rats died, 20%) (P < 0.05).

Cardiovascular evaluations.   At the 7-day time point, all infarcted animals had similar myocardial infarction size demonstrated by a mean akinesia score of 4.2 ± 0.2 vs. 0 ± 0 in sham (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 1. Hemodynamic parameters

 
At 1 mo, rats in the MI group had a 42% increase in LVEDD, suggesting significant LV remodeling (P < 0.05) and a high score of akinesia (~50% of the left ventricle). This alteration was associated with a marked reduction of the cardiac contractility evaluated by the shortening fraction (FS, –59%; P < 0.05) whereas blood pressure was not significantly modified.

At 4 mo, remodeling and cardiac dysfunction again were significant in MI rats, leading to a decreased systemic blood pressure compared with sham-operated rats (–16%; P < 0.05), further supporting aggravation of heart failure, which likely explains the mortality observed in untreated animals.

ACEi with PE markedly reduced the score of akinesia (–23%; P < 0.05 vs. MI after 1 mo and –43%; P < 0.05 vs. MI after 4 mo), reduced LV dilatation after 1 mo of treatment (–10%; P < 0.05 vs. MI), and tended to increase FS (+36% in MI-PE rats compared with nontreated MI animals; P = 0.07) at 4 mo. The decrease of systemic blood pressure in treated rats was not statistically significant, compared with controls. Therefore, 1 and 4 mo after coronary artery ligation, ACEi attenuated MI-induced cardiovascular alterations.

Skeletal muscle mitochondrial function.   To assess the main mitochondrial metabolic pathways, we measured the respiratory rates of in situ mitochondria in Gas muscle at saturating ADP concentration (Vmax) in the presence of different mitochondrial substrates. This technique ensures determination of global mitochondrial function, reflecting both the density as well as the properties of the skeletal muscle mitochondria.

The results are reported in Fig. 1. One month after surgery, the ability of the Gas to use glutamate-malate, G3P, palmitoyl carnitine, or pyruvate was not significantly altered in MI animals (Fig. 1A). However, 4 mo after surgery, Vmax was largely decreased with glutamate-malate (–30%, P < 0.01), G3P (–32%, P < 0.05), and pyruvate (–33%, P < 0.01) in Gas of MI rats. On the other hand, ACR was not altered (4.3 ± 0.2 in sham vs. 5.2 ± 0.7 in MI), demonstrating that the degree of coupling between oxidation and phosphorylation was not impaired in MI animals.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
 
Fig. 1. Maximal ADP-stimulated rates of respiration of mitochondria (Vmax) in situ in permeabilized superficial gastrocnemius skeletal muscle, after 1 (A) and 4 (B) mo of treatment. Mitochondrial substrates were glutamate and malate (G+M), palmitoyl carnitine and malate (PC+M), glycerol-3-phosphate (G3P), or pyruvate and malate. Values are expressed as µmol O2·min–1·g fiber dry wt–1. Values are means ± SE. Significantly different from sham: *P < 0.05; **P < 0.01; significantly different from MI: §§P < 0.01.

 
Importantly, PE significantly improved mitochondrial metabolic pathways as attested by the significant increase of the muscle Vmax in the MI treated with PE compared with the nontreated MI rats (+57 and +47%, respectively with glutamate-malate and pyruvate as substrates; P < 0.001). Moreover, as Vmax in MI-PE rats did not differ from Sham whatever the substrate used, this shows that PE treatment was able to normalize skeletal muscle mitochondrial function (Fig. 1B). The ACR was not different between MI (5.2 ± 0.7) and MI-PE rats (4.4 ± 0.1).

Similarly, muscle activities of citrate synthase, a Krebs cycle enzyme, and of cytochrome oxidase, complex IV of the respiratory chain, were significantly depressed at 4 mo in MI rats (9.3 ± 0.5 IU/g wet wt, P < 0.05, and 2.11 ± 0.06 IU/g wet wt, P < 0.001, respectively) compared with sham (11.9 ± 0.7 and 3.3 ± 0.1 IU/g wet wt, respectively) and fully recovered after PE treatment (10.9 ± 2.0 and 3.1 ± 0.6 IU/g wet wt, respectively, not significant vs. sham group).

mRNA levels of nuclear factors associated with mitochondrial biogenesis in Gas muscle.   To evaluate whether alterations in Gas muscle mitochondrial function could be the consequence of alterations in mitochondrial gene expression, we assessed the mRNA levels of mitochondrial transcription factors 4 mo after MI. MI led to significant reductions in muscle mRNAs coding for the coactivator of transcription PGC-1{alpha} and for the transcription factor NRF-2{alpha} (–54 and –45%, respectively, P < 0.05) and tended to reduce mtTFA (–22%, P = 0.06) 4 mo after surgery (Fig. 2). Thus metabolic defects of skeletal muscle were associated with a decrease in the expression of key transcription factors involved in the regulation of mitochondrial biogenesis.


Figure 2
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. Real-time quantitative RT-PCR analysis of mRNA expression of peroxisome proliferator activated receptor gamma coactivator 1{alpha} (PGC-1{alpha}, A), nuclear respiratory factor 2 DNA-binding subunit {alpha} (NRF-2{alpha}, B), and mitochondrial transcription factor A (mtTFA, C) in gastrocnemius of sham-operated, myocardial infarction rats nontreated (MI), or treated with perindopril (MI-PE), 4 mo after coronary artery ligation. GCB, glucocerebrosidase. Values are means ± SE. Significantly different from sham: *P < 0.05; significantly different from MI: §P < 0.05.

 
PE treatment significantly increased the mRNA levels of PGC1-{alpha} (+129% compared with MI, P < 0.05) and NRF-2{alpha} (+91% compared with MI, P < 0.05), whereas mtTFA showed a tendency to be increased (+50% compared with MI, P < 0.06). Then treatment with the ACEi restored the mRNA expression of all theses factors, reaching the values of the Sham-operated animals.

Significant positive correlations (P < 0.001) were found between PGC-1{alpha} mRNA expression and both transcriptional factors mtTFA and NRF-2{alpha} (r = 0.88 and r = 0.70, respectively). Moreover, positive correlations (P < 0.05) were observed between PGC-1{alpha} mRNA content on one hand and muscle oxidative capacity (Vmax, r = 0.48), mitochondrial marker cytochrome-c oxidase (r = 0.65), or citrate synthase activities (r = 0.45), on the other (Fig. 3).


Figure 3
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. Correlations between the mRNA expression level of PGC-1{alpha} and mitochondrial function (Vmax, A), enzymatic activities of cytochrome-c oxidase (COX, B), and citrate synthase (CS, C) in skeletal muscle of MI or MI-PE rats, 4 mo after coronary artery ligation. r, Correlation coefficient; P, statistical significance.

 
Interestingly, the content of MCIP1 mRNA, which is a marker of calcineurin activation, was downregulated in the Gas after MI. It significantly recovered under ACEi (Fig. 4A).


Figure 4
View larger version (10K):
[in this window]
[in a new window]
 
Fig. 4. Real-time quantitative RT-PCR analysis of mRNA expression of myocyte-enriched calcineurin interacting protein 1 (MCIP1) in gastrocnemius of MI or MI-PE rats, 4 mo after coronary artery ligation. Values are means ± SE. Significantly different from sham: *P < 0.05; significantly different from MI: §P < 0.05.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
The present investigation demonstrates that ACEi totally prevented the impairments of skeletal muscle mitochondrial function observed 4 mo after MI. Furthermore, the downregulation of gene expression of the mitochondrial transcriptional factors PGC-1{alpha}, NRF-2{alpha}, and mtTFA was also prevented, suggesting that ACEi protects skeletal muscle through a preservation of mitochondrial biogenesis.

Cardiovascular and muscular effects of myocardial infarction.   MI-induced LV dysfunction was characterized by a significant LV dilatation and a reduced FS related to LV akinesia. Systemic blood pressure decreased significantly at 4 mo after MI, secondary to cardiac failure. Similar to other studies (2, 3, 14, 26), mitochondrial capacity, enzyme activities, and mitochondrial function were decreased in skeletal muscle of MI rats.

This study extends our knowledge of skeletal muscle energetics in heart failure by demonstrating that the three main mitochondrial oxidation pathways (pyruvate, G3P, and glutamate-malate substrates) were functionally impaired. Accordingly, two markers of mitochondrial mass, citrate synthase and cytochrome oxidase, were also decreased. Recently, Ponsot et al. (19) have found that Gas poorly oxidizes palmitoyl carnitine. Our data indicate that oxidation rates of palmitoyl carnitine were not significantly modified after MI (see Fig. 1).

Interestingly, as in pressure overload-induced heart failure (8), MI-induced mitochondrial defects were associated with a decreased expression of transcription factors involved in the regulation of mitochondrial biogenesis. Thus expression of NRF-2{alpha}, for which recognition sites have been described on genes encoding mtTFA and mitochondrial proteins in rodents (21), and PGC-1{alpha}, which is the major positive factor of muscle mitochondrial biogenesis (8, 9, 29) functioning through its interaction with NRFs, were reduced in MI rats. The relationships observed between transcriptional factors implicated in the mitochondrial biogenesis and the muscle oxidative capacities suggest that the decreased oxidative capacity in skeletal muscle of MI rats results from diminished mitochondrial gene expression, linked to PGC-1{alpha}, NRFs, and mtTFA downregulation.

Cardiovascular and muscular effects of ACE inhibition.   ACEi decreased mortality and significantly improved MI-induced cardiac dysfunction by limiting LV dilatation and LV wall akinesia, both 1 and 4 mo after surgery, supporting a beneficial effect of PE on infarction-induced cardiac failure. This is the first report that indicates that 4 mo of PE completely prevented the decreased ability of Gas mitochondria to oxidize metabolic substrates in MI rats. The efficacy of ACEi treatment was significant in all animals but exhibited a large range of effects from +20% to +85%. Skeletal muscle mitochondrial density is decreased in CHF (23, 26). Therefore, it is tempting to speculate that ACEi protected mitochondrial function through mitochondrial biogenesis. Indeed, mRNA levels of the main nuclear factors regulating mitochondrial biogenesis were preserved in treated MI rats. Moreover, positive correlations between the main factor controlling mitochondrial biogenesis, PGC-1{alpha}, and the skeletal muscle oxidative capacities were observed. A role for muscle deconditioning, which is known to affect PGC-1{alpha} expression and oxidative capacity, can be discarded for several reasons. First, Simonini et al. (23) showed that heart failure produces changes in skeletal muscle gene expression that cannot be explained by a decrease in activity. Second, and in accordance with another study (25), correlations between activity and the subsequently measured LV end-diastolic pressure, infarct size, and right ventricular weight were all poor (r > 0.16 for each relationship), indicating that the level of activity was not related to the severity of heart failure (23). Finally, ACEi treatment does not affect endurance capacity in normal rats (1). Thus we can certainly rule out that ACEi has a direct impact on the activity level of rats maintained in their cages. Taken together, our results suggest that the preserved expression of transcriptional factors implicated in mitochondrial biogenesis participate in the protecting effect of ACEi on skeletal muscle oxidative capacities.

Several hypotheses deserve to be discussed concerning the mechanisms involved in these results. It is unlikely that ACEi directly affected the expression of PGC-1{alpha} because ACEi did not improve maximal oxidative capacity of skeletal muscles, nor endurance time in normal rats (1). Similarly, a direct negative effect of angiotensin II on the transcriptional regulation of muscular metabolism could probably be ruled out. Indeed, ACEi failed to protect skeletal muscle energetic metabolism in a model of chronic LV dysfunction induced by aortic stenosis, likely due to chronic inadequate peripheral microcirculation downstream from the clip (16). In this regard, some tissue effects of ACE inhibitors (i.e., restoration of endothelial function, decrease in oxidative stress, and increase in muscular capillary density) have been demonstrated in both experimental models and human studies (7) and could be linked to the metabolic protective effects of ACEi, because all potentially could activate intracellular cascades participating in oxidative metabolism regulation.

Relative to the signaling pathways, modulation of gene expression by the calcium-sensitive phosphatase calcineurin is largely involved in the remodeling of skeletal muscle. Recent data suggest that PGC-1{alpha} is a target of calcineurin (13), contributing to muscle fiber-type determination and formation of slow-twitch muscle fibers (10). MCIP1 is a marker of calcineurin activation in vivo because its expression is rapidly and robustly regulated by calcineurin (31). In the present investigation, skeletal muscle expression of MCIP1 was determined in all rodents. Interestingly, MCIP1 was decreased after MI, and ACEi treatment was able to weaken this decrease. Our data suggest that, first, calcineurin activity is decreased in skeletal muscle after MI, and second, ACEi preserves calcineurin activation. This result compares well with preserved MCIP1 expression in CHF patients under ACEi therapy, having normal oxidative capacity and expression of mitochondrial transcription factors (9). However, it is not possible at present to establish a cause-and-effect relationship between calcineurin activation and PGC-1 expression. Although our data suggest that calcineurin activation may participate in the changes in skeletal muscle mitochondrial function in heart failure and in the beneficial effects of ACEi, further studies using gain and loss of function of calcineurin would be necessary to make stronger statements.

Clinical relevance of these results.   Although it was widely accepted that heart failure patients exhibit decreased skeletal muscle mitochondrial activity (6, 14, 24, 27), recent studies on ACEi-treated CHF patients failed to observe alterations in mitochondrial function, mitochondrial enzyme activity, or expression of mitochondrial proteins or transcription factors in skeletal muscles, compared with sedentary controls (15, 28). The present results may shed light on these apparently contradictory observations, by showing that ACEi treatment, missing in the previous studies, is able to reduce skeletal muscle metabolic derangements by preventing the decrease in gene expression of mitochondrial proteins. Thus ACEi treatment given early after infarction prevents the development of the myopathy. Whether ACEi could reverse the skeletal muscle metabolic myopathy, if given later after infarction, remains to be studied. Moreover, AT1 receptor antagonists use might be interesting to further investigate the mechanisms protecting the skeletal muscle mitochondrial function.

In conclusion, this study shows that chronic treatment with ACEi after myocardial infarction protects the mitochondrial function of skeletal muscle through a preservation of mitochondrial protein expression. Our data underscore the importance of ACEi therapy in heart failure patients and improve the knowledge concerning the protection of skeletal muscle metabolism. This could help to adapt strategies aiming to ameliorate the rehabilitation of the numerous patients suffering from chronic diseases associated with exercise intolerance and impaired skeletal muscles functions. Future studies will therefore be useful to further define the precise mechanisms mediating such ACEi-induced beneficial effect on skeletal muscle energetics.


    ACKNOWLEDGMENTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 
We thank D. Fortin and I. Bentz for helpful technical assistance. R. Ventura-Clapier is supported by Centre national de la recherche scientifique. We thank the laboratory team of Servier France for the kind gift of PE.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. Zoll, Département de Physiologie, Faculté de Médecine, 11, rue Humann, 67000 Strasbourg, France (e-mail: Zolljoffrey{at}yahoo.com)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* J. Zoll and L. Monassier contributed equally to the paper. Back


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGMENTS
 REFERENCES
 

  1. Bahi L, Koulmann N, Sanchez H, Momken I, Veksler V, Bigard AX, and Ventura-Clapier R. Does ACE inhibition enhance endurance performance and muscle energy metabolism in rats? J Appl Physiol 96: 59–64, 2004.[Abstract/Free Full Text]
  2. De Sousa E, Lechene P, Fortin D, N'Guessan B, Belmadani S, Bigard X, Veksler V, and Ventura-Clapier R. Cardiac and skeletal muscle energy metabolism in heart failure: beneficial effects of voluntary activity. Cardiovasc Res 56: 260–268, 2002.[Abstract/Free Full Text]
  3. De Sousa E, Veksler V, Bigard X, Mateo P, and Ventura-Clapier R. Heart failure affects mitochondrial but not myofibrillar intrinsic properties of skeletal muscle. Circulation 102: 1847–1853, 2000.[Abstract/Free Full Text]
  4. De Sousa E, Veksler V, Minajeva A, Kaasik A, Mateo P, Mayoux E, Hoerter J, Bigard X, Serrurier B, and Ventura-Clapier R. Subcellular creatine kinase alterations. Implications in heart failure. Circ Res 85: 68–76, 1999.[Abstract/Free Full Text]
  5. Drexler H, Banhardt U, Meinertz T, Wollschlager H, Lehmann M, and Just H. Contrasting peripheral short-term and long-term effects of converting enzyme inhibition in patients with congestive heart failure. A double-blind, placebo-controlled trial. Circulation 79: 491–502, 1989.[Abstract/Free Full Text]
  6. Drexler H, Riede U, Munzel T, Konig H, Funke E, and Just H. Alterations of skeletal muscle in chronic heart failure. Circulation 85: 1751–1759, 1992.[Abstract/Free Full Text]
  7. Dzau VJ, Bernstein K, Celermajer D, Cohen J, Dahlof B, Deanfield J, Diez J, Drexler H, Ferrari R, van Gilst W, Hansson L, Hornig B, Husain A, Johnston C, Lazar H, Lonn E, Luscher T, Mancini J, Mimran A, Pepine C, Rabelink T, Remme W, Ruilope L, Ruzicka M, Schunkert H, Swedberg K, Unger T, Vaughan D, and Weber M. The relevance of tissue angiotensin-converting enzyme: manifestations in mechanistic and endpoint data. Am J Cardiol 88: 1L–20L, 2001.[Web of Science][Medline]
  8. Garnier A, Fortin D, Delomenie C, Momken I, Veksler V, and Ventura-Clapier R. Depressed mitochondrial transcription factors and oxidative capacity in rat failing cardiac and skeletal muscles. J Physiol 551: 491–501, 2003.[Abstract/Free Full Text]
  9. Garnier A, Fortin D, Zoll J, N'Guessan B, Mettauer B, Lampert E, Veksler V, and Ventura-Clapier R. Coordinated changes in mitochondrial function and biogenesis in healthy and diseased human skeletal muscle. FASEB J 19: 43–52, 2005.[Abstract/Free Full Text]
  10. Handschin C, Rhee J, Lin J, Tarr PT, and Spiegelman BM. An autoregulatory loop controls peroxisome proliferator-activated receptor gamma coactivator 1alpha expression in muscle. Proc Natl Acad Sci USA 100: 7111–7116, 2003.[Abstract/Free Full Text]
  11. Hood DA. Invited Review: Contractile activity-induced mitochondrial biogenesis in skeletal muscle. J Appl Physiol 90: 1137–1157, 2001.[Abstract/Free Full Text]
  12. Hugel S, Horn M, de Groot M, Remkes H, Dienesch C, Hu K, Ertl G, and Neubauer S. Effects of ACE inhibition and beta-receptor blockade on energy metabolism in rats postmyocardial infarction. Am J Physiol Heart Circ Physiol 277: H2167–H2175, 1999.[Abstract/Free Full Text]
  13. Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, Michael LF, Puigserver P, Isotani E, Olson EN, Lowell BB, Bassel-Duby R, and Spiegelman BM. Transcriptional coactivator PGC-1 alpha drives the formation of slow-twitch muscle fibres. Nature 418: 797–801, 2002.[CrossRef][Medline]
  14. Massie BM, Simonini A, Sahgal P, Wells L, and Dudley GA. Relation of systemic and local muscle exercise capacity to skeletal muscle characteristics in men with congestive heart failure. J Am Coll Cardiol 27: 140–145, 1996.[Abstract]
  15. Mettauer B, Zoll J, Sanchez H, Lampert E, Ribera F, Veksler V, Bigard X, Mateo P, Epailly E, Lonsdorfer J, and Ventura-Clapier R. Oxidative capacity of skeletal muscle in heart failure patients versus sedentary or active control subjects. J Am Coll Cardiol 38: 947–954, 2001.[Abstract/Free Full Text]
  16. Momken I, Kahapip J, Bahi L, Badoual T, Hittinger L, Ventura-Clapier R, and Veksler V. Does angiotensin-converting enzyme inhibition improve the energetic status of cardiac and skeletal muscles in heart failure induced by aortic stenosis in rats? J Mol Cell Cardiol 35: 399–407, 2003.[CrossRef][Web of Science][Medline]
  17. Mulder P, Elfertak L, Richard V, Compagnon P, Devaux B, Henry JP, Scalbert E, Desche P, Mace B, and Thuille ZC. Peripheral artery structure and endothelial function in heart failure: effect of ACE inhibition. Am J Physiol Heart Circ Physiol 271: H469–H477, 1996.[Abstract/Free Full Text]
  18. N'Guessan B, Zoll J, Ribera F, Ponsot E, Lampert E, Ventura-Clapier R, Veksler V, and Mettauer B. Evaluation of quantitative and qualitative aspects of mitochondrial function in human skeletal and cardiac muscles. Mol Cell Biochem 256–257: 267–280, 2004.
  19. Ponsot E, Zoll J, N'Guessan B, Ribera F, Lampert E, Richard R, Veksler V, Ventura-Clapier R, and Mettauer B. Mitochondrial tissue specificity of substrates utilization in rat cardiac and skeletal muscles. J Cell Physiol 203: 479–486, 2005.[CrossRef][Web of Science][Medline]
  20. Sanbe A, Tanonaka K, Kobayasi R, and Takeo S. Effects of long-term therapy with ACE inhibitors, captopril, enalapril and trandolapril, on myocardial energy metabolism in rats with heart failure following myocardial infarction. J Mol Cell Cardiol 27: 2209–2222, 1995.[CrossRef][Web of Science][Medline]
  21. Scarpulla RC. Nuclear activators and coactivators in mammalian mitochondrial biogenesis. Biochim Biophys Acta 1576: 1–14, 2002.[Medline]
  22. Schieffer B, Wollert KC, Berchtold M, Saal K, Schieffer E, Hornig B, Riede UN, and Drexler H. Development and prevention of skeletal muscle structural alterations after experimental myocardial infarction. Am J Physiol Heart Circ Physiol 269: H1507–H1513, 1995.[Abstract/Free Full Text]
  23. Simonini A, Long CS, Dudley GA, Yue P, McElhinny J, and Massie BM. Heart failure in rats causes changes in skeletal muscle morphology and gene expression that are not explained by reduced activity. Circ Res 79: 128–136, 1996.[Abstract/Free Full Text]
  24. Sullivan MJ, Duscha BD, Klitgaard H, Kraus WE, Cobb FR, and Saltin B. Altered expression of myosin heavy chain in human skeletal muscle in chronic heart failure. Med Sci Sports Exerc 29: 860–866, 1997.
  25. Teerlink JR and Clozel JP. Hemodynamic variability and circadian rhythm in rats with heart failure: role of locomotor activity. Am J Physiol Heart Circ Physiol 264: H2111–H2118, 1993.[Abstract/Free Full Text]
  26. Ventura-Clapier R, De Sousa E, and Veksler V. Metabolic myopathy in heart failure. News Physiol Sci 17: 191–196, 2002.[Abstract/Free Full Text]
  27. Ventura-Clapier R, Garnier A, and Veksler V. Energy metabolism in heart failure. J Physiol 555: 1–13, 2004.[Abstract/Free Full Text]
  28. Williams AD, Selig S, Hare DL, Hayes A, Krum H, Patterson J, Geerling RH, Toia D, and Carey MF. Reduced exercise tolerance in CHF may be related to factors other than impaired skeletal muscle oxidative capacity. J Card Fail 10: 141–148, 2004.[CrossRef][Web of Science][Medline]
  29. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, Troy A, Cinti S, Lowell B, Scarpulla RC, and Spiegelman BM. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98: 115–124, 1999.[CrossRef][Web of Science][Medline]
  30. Yamaguchi F, Kawana K, Tanonaka K, Kamano I, Igarashi T, Gen E, Fujimoto Y, Maki T, Sanbe A, Nasa Y, and Takeo S. Improvement of exercise capacity of rats with chronic heart failure by long-term treatment with trandolapril. Br J Pharmacol 126: 1585–1592, 1999.[CrossRef][Web of Science][Medline]
  31. Yang J, Rothermel B, Vega RB, Frey N, McKinsey TA, Olson EN, Bassel-Duby R, and Williams RS. Independent signals control expression of the calcineurin inhibitory proteins MCIP1 and MCIP2 in striated muscles. Circ Res 87: E61–E68, 2000.[Web of Science][Medline]
  32. Zoll J, N'Guessan B, Ribera F, Lampert E, Fortin D, Veksler V, Bigard X, Geny B, Lonsdorfer J, Ventura-Clapier R, and Mettauer B. Preserved response of mitochondrial function to short-term endurance training in skeletal muscle of heart transplant recipients. J Am Coll Cardiol 42: 126–132, 2003.[Abstract/Free Full Text]
  33. Zoll J, Sanchez H, N'Guessan B, Ribera F, Lampert E, Bigard X, Serrurier B, Fortin D, Geny B, Veksler V, Ventura-Clapier R, and Mettauer B. Physical activity changes the regulation of mitochondrial respiration in human skeletal muscle. J Physiol 543: 191–200, 2002.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Appl. Physiol.Home page
E. Habouzit, H. Richard, H. Sanchez, N. Koulmann, B. Serrurier, R. Monnet, R. Ventura-Clapier, and X. Bigard
Decreased muscle ACE activity enhances functional response to endurance training in rats, without change in muscle oxidative capacity or contractile phenotype
J Appl Physiol, July 1, 2009; 107(1): 346 - 353.
[Abstract] [Full Text] [PDF]


Home page
Circ Heart FailHome page
A. Garnier, J. Zoll, D. Fortin, B. N'Guessan, F. Lefebvre, B. Geny, B. Mettauer, V. Veksler, and R. Ventura-Clapier
Control by Circulating Factors of Mitochondrial Function and Transcription Cascade in Heart Failure: A Role for Endothelin-1 and Angiotensin II
Circ Heart Fail, July 1, 2009; 2(4): 342 - 350.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. Ventura-Clapier, A. Garnier, and V. Veksler
Transcriptional control of mitochondrial biogenesis: the central role of PGC-1{alpha}
Cardiovasc Res, July 15, 2008; 79(2): 208 - 217.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
A. Mezzani, U. Corra, C. Andriani, A. Giordano, R. Colombo, and P. Giannuzzi
Anaerobic and aerobic relative contribution to total energy release during supramaximal effort in patients with left ventricular dysfunction
J Appl Physiol, January 1, 2008; 104(1): 97 - 102.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
O. Rouyer, J. Zoll, F. Daussin, C. Damge, P. Helms, S. Talha, L. Rasseneur, F. Piquard, and B. Geny
Muscle: Effect of angiotensin-converting enzyme inhibition on skeletal muscle oxidative function and exercise capacity in streptozotocin-induced diabetic rats
Exp Physiol, November 1, 2007; 92(6): 1047 - 1056.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. Ventura-Clapier, B. Mettauer, and X. Bigard
Beneficial effects of endurance training on cardiac and skeletal muscle energy metabolism in heart failure
Cardiovasc Res, January 1, 2007; 73(1): 10 - 18.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
101/2/385    most recent
01486.2005v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zoll, J.
Right arrow Articles by Geny, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zoll, J.
Right arrow Articles by Geny, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.