Journal of Applied Physiology AJP citation statistics
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

J Appl Physiol 100: 1499-1505, 2006. First published December 15, 2005; doi:10.1152/japplphysiol.00865.2005
8750-7587/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
100/5/1499    most recent
00865.2005v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cieniewski-Bernard, C.
Right arrow Articles by Bastide, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cieniewski-Bernard, C.
Right arrow Articles by Bastide, B.

O-GlcNAc level variations are associated with the development of skeletal muscle atrophy

Caroline Cieniewski-Bernard,1 Yvonne Mounier,2 Jean-Claude Michalski,1 and Bruno Bastide2

1Unité Mixte de Recherche Centre National de la Recherche Scientifique 8576, Glycobiologie Structurale et Fonctionnelle, Institut Fédératif de Recherche 118, and 2Laboratoire de Plasticité Neuromusculaire, EA1032, IFR118, Université des Sciences et Technologies de Lille, Villeneuve d'Ascq Cedex, France

Submitted 18 July 2005 ; accepted in final form 13 December 2005


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
O-linked N-acetylglucosaminylation (O-GlcNAc) is a regulatory posttranslational modification of nucleocytoplasmic proteins, which consists of the attachment of N-acetylglucosamine to serine or threonine residues of a protein. This glycosylation is a ubiquitous posttranslational modification, which probably plays important roles in many aspects of protein function. Our laboratory has previously reported that, in skeletal muscle, proteins of the glycolytic pathway and energetic metabolism and contractile proteins were O-GlcNAc modified (Cieniewski-Bernard C, Bastide B, Lefebvre T, Lemoine J, Mounier Y, and Michalski JC. Mol Cell Proteomics 3: 577–585, 2004). O-GlcNAc has been recently demonstrated to play a role in modulating cellular function in response to nutrition and also in stress conditions. Therefore, we have investigated here the implication of the glycosylation/deglycosylation process in the development of atrophy in rat skeletal muscle after hindlimb unloading. The high O-GlcNAc level found in control soleus [compared with control extensor digitorum longus (EDL)] becomes lower in atrophied soleus. On the opposite side, the low rate of O-GlcNAc in control EDL reaches higher levels in EDL, not atrophied after hindlimb unloading. These variations in O-GlcNAc level are correlated with a variation of the O-GlcNAc process enzyme activities and could be associated with a differential expression of heat shock proteins. Our results suggest that O-GlcNAc variations could control the muscle protein homeostasis and be implicated in the regulation of muscular atrophy.

O-linked N-acetylglucosaminylation; hindlimb unloading; oxidative stress; heat shock proteins

O-LINKED N-acetylglucosamine, termed O-GlcNAc, is an abundant, ubiquitous posttranslational modification (25). It consists of the transfer of a unique monosaccharide, N-acetylglucosamine, by a beta-linkage on a serine/threonine hydroxyl group of a protein. The highest concentration of O-GlcNAc-bearing proteins is localized in the nucleus and cytoplasm (9). The O-GlcNAc modification is highly dynamic, and the half-life of the monosaccharide is shorter than the protein backbone on which it is attached (21). Because of the existence of uridine diphospho-N-acetyl glucosaminyl transferase (EC 2.4.1.94 [EC] ) (6), which transfers the monosaccharide on a protein, and a neutral beta-N-acetylglucosaminidase (O-GlcNAcase; EC 3.2.1.52 [EC] ) (4), which removes it, O-GlcNAc is highly reversible. O-GlcNAc occurs on the same sites or at neighboring sites as phosphate moieties, and all of the O-GlcNAc proteins identified to date are also phosphoproteins, which implies a reciprocal relationship between O-GlcNAcylation and phosphorylation. Thus one function of O-GlcNAc may be to prevent phosphorylation sites from being phosphorylated and, therefore, constitutes an additional level of control of the regulation of phosphorylated molecules. The balance O-GlcNAc/phosphorylation has been described on total level of proteins (15), as well as on isolated protein (1, 2, 12). Other studies seem to indicate that O-GlcNAc could protect proteins against proteasomal degradation by modifying the target proteins (1, 5) and the proteasome itself, with O-GlcNAc moiety acting as an inhibitor of the proteolysis function (23, 29). Moreover, the O-GlcNAc modification has also been shown to be activated in response to glucose metabolism (26), insulin signaling (27), and stress (28).

Key proteins involved in the skeletal muscle metabolism and in the contractile process have recently been identified as O-GlcNAc (3). However, the implication of O-GlcNAc in muscle function remains speculative. Nevertheless, muscular metabolism as well as contraction process are highly dependent on glucose and UDP-GlcNAc, the sugar donor for O-GlcNAc, and phosphorylation/dephosphorylation processes.

Skeletal muscle fibers are able to adjust their phenotype and functions to altered functional demands in response to exercise, disuse, environmental influence, or pathological processes. Hindlimb unloading (HU) is a model of functional atrophy characterized by a slow-to-fast phenotype transition of slow postural muscles such as the soleus, with the fast hindlimb muscles being less affected. The atrophy, characterized by a significant decrease in muscle mass (24) and in myofibril protein content (18), results in a dramatic reduction in the muscle's ability to generate force.

We investigated the variation and the role of O-GlcNAc in a model of functional muscular atrophy to determine whether the glycosylation could be involved in the regulation of muscular atrophy.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Biochemicals.   Bovine galactosyltransferase and all chemical reagents were purchased from Sigma Aldrich (St. Louis, MO); UDP-[3H]Gal, secondary antibodies, and enhanced chemiluminescence Western blotting detection reagent from Amersham Pharmacia Biotech (Piscataway, NJ); polyclonal anti-heat shock protein 70 (HSP70) antibodies from Tebu (Newcastle, UK); nitrocellulose sheet from Pall (Pensacola, FL); Maxiclean cartridges C18 from Alltech (Deerfield, IL); MicroBCA Protein Assay Reagent Kit from Pierce (Rockford, IL); thin-layer chromatography (TLC) aluminum sheet from Merck (Darmstadt, Germany); synthetic peptide YSDSPSTST from Neosystem (Strasbourg, France); peptide-N-glycosidase F (PNGase F) from New England Biolabs (Beverly, MA); MicroPolyA Pure kit from Ambion; and Titan One Step RT-PCR kit and agarose molecular screening from Roche.

Animals and muscle preparation.   Experiments were carried out on skeletal muscles of adult male Wistar rats. The experiments as well as the maintenance conditions of the animals received authorization from the Ministry of Agriculture and the Ministry of Education (veterinary service of health and animal protection, authorization 03805).

Soleus (a typical slow postural muscle) and extensor digitorum longus (EDL) (a typical fast muscle) muscles were removed from male Wistar rats, which were anesthetized with an intraperitoneal injection of pentobarbital sodium (3 mg/kg), quickly frozen, and pulverized in liquid nitrogen. All samples were kept at –80°C until analyzed.

For the analysis of the O-GlcNAc levels as well as the expression of O-GlcNAc enzymes after HU, the rats were divided into four groups of six rats each. Two groups of rats were submitted, respectively, to 14 and 28 days of HU using the model of Morey et al. (19). The animals had free access to food and water, and daily consumption of rat chow and water was monitored. The animals were not allowed to come out of suspension at any time before muscle harvest. The two other groups were composed of nonsuspended animals constituting respective control groups for the two HU groups. All groups of animals were age and weight matched. After 14 and 28 days of control or, respectively, 14 and 28 days of HU, animals were killed, and muscles were prepared as described above. The slow soleus muscle was chosen as this postural muscle is particularly affected by HU, presenting clear slow-to-fast transitions and atrophy in contrast to the fast EDL muscle. Since no significant difference was measured between control samples corresponding to 14 days and 28 days, we presented 28 days of control in Figs. 1–5.


Figure 1
View larger version (15K):
[in this window]
[in a new window]
  		Fig. 1. Determination of the O-linked N-acetylglucosaminylation (O-GlcNAc) level variations and the development of atrophy after hindlimb unloading (HU) in soleus (SOL) and extensor digitorum longus (EDL) muscles. A: the total O-GlcNAc level, expressed in ng of O-GlcNAc per 100 µg of skeletal muscle proteins (prot), was determined after radioactive labeling of O-GlcNAc proteins with tritiated galactose residue. B: muscle weight during HU expressed relative to the animal weight. Measurements were performed on SOL (S) and EDL (E), in control conditions (SC and EC), after 14 days of HU (S14 and E14), and after 28 days of HU (S28 and E28). Data are presented as means ± SE; n = 6 for each group. *Significant difference from control (P < 0.05).

 

Figure 5
View larger version (10K):
[in this window]
[in a new window]
  		Fig. 5. Immunoblot analysis of the expression of the heat shock proteins (HSP) 70 after HU. A: HSP70 signal intensities measured on immunoblots from SOL and EDL muscle homogenates. All measurements were made on a same blot for the two samples corresponding to 10 µg of proteins per lane (n = 4). *Significant difference (P < 0.05). B: densitometric analysis of HSP70 expression in SOL and EDL muscle during HU. Skeletal muscle proteins were separated on 10% gel electrophoresis and electroblotted on a nitrocellulose membrane (n = 4). HSP70 was revealed using specific antibodies. Data are presented as means ± SE; n = 4 for each group. *Significant difference with the control (P < 0.05).

 
Total O-GlcNAc level assay.   The level of O-GlcNAc on skeletal muscle proteins was measured on 100 µg of proteins (MicroBCA Protein Assay) by a radioactive labeling, as previously described (22). To 50 µl of solubilized sample, 50 mU of autogalactosylated galactosyltransferase diluted in 10 µl of 10x labeling buffer (100 mM HEPES-NaOH, 100 mM galactose, 50 mM MnCl2, pH 7.3) were added. The volume was adjusted to 90 µl with water. The reaction was initiated by adding 10 µl of 25 mM 5'-AMP containing 3 µCi of UDP-[3H]Gal to bring the final concentration to 2.5 mM 5'-AMP. The sample was incubated 2 h at 37°C in the presence of 40 µM O-(2-acetamido-2-deoxy-D-glucopyranosylidene)amino-N-phenylcarbamate. The reaction was stopped by boiling for 5 min. Radioactive precursor was eliminated by passing through a column of Dowex 1 x 2 (200–400 mesh) in its acetate form. The column was washed with water, and the nonretained fraction was counted by liquid scintillation after the addition of Aquasafe on the Beckman LS6000TA apparatus. The level of O-GlcNAc labeled with [3H]Gal was determined using the specific radioactivity of UDP-[3H]Gal and the efficiency of the counting. All measurements were made twice for six different samples.

Characterization of the sugar moieties.   One hundred micrograms of labeled glycoproteins were used for this experiment. As previously described (3), proteins were first N-deglycosylated using PNGase F (manufacturer's specifications). Reductive beta-elimination was performed. Reaction was obtained with final concentrations of 0.1 M NaOH and 1 M BH4Na for 18 h at 45°C. Reaction was stopped by addition of Dowex 50 x 8 (20–50 mesh) in its H+ form on ice, and the resin was then eliminated by filtration on glass fiber. Solution containing beta-eliminated products was then desalted on a C18 column equilibrated in 0.1% trifluoroacetate in water, and elution was performed with 0.1% trifluoroacetate in can acetonitrile-water (60:40 vol/vol). The eluted sample was dried on vacuum centrifuge, resuspended in 10 µl of water, and analyzed by a TLC. With BuOH/CH3COOH/H2O (40:20:30 vol/vol/vol) as a solvent, radiolabeled N-acetyllactosaminitol was used as a standard. Revelation was developed either with sulphuric orcinol staining on TLC or autoradiography after 1 mo.

O-GlcNAc transferase assay.   The assay was performed on 200 µg of muscular proteins (MicroBCA Protein Assay), as previously described (13). The reaction mixture contained 50 mM sodium cacodylate (pH 6.5), 5 mM MnCl2, 2.5 mM 5'-AMP, 100 nmol of synthetic peptide YSDSPSTST, and 0.5 µCi UDP-[14C]GlcNAc. The reaction was carried out for 2 h 30 min at room temperature and then stopped by the addition of formic acid to bring a final concentration of 45 mM. Radioactive precursor was eliminated by passing the solution through a C18 column equilibrated in 50 mM formic acid; elution was performed with acetonitrile-water (50:50 vol/vol). After evaporation, the sample was resuspended in water and counted by liquid scintillation after the addition of Aquasafe using a Beckman LS6000TA counter. Activity was determined considering the specific radioactivity of UDP-[14C]GlcNAc and the efficiency of the counting. This experiment is characterized by three assays for each group made twice.

O-GlcNAcase assay.   The assay was performed on 200 µg of muscular proteins (MicroBCA Protein Assay), according to Ref. 4. The reaction mixture contained 50 mM sodium cacodylate (pH 6.5), 1 mM N-acetylgalactosamine, and 2 mM para-nitrophenol-GlcNAc. Reaction was performed for 2 h at 37°C, and it was then stopped by the addition of sodium carbonate to bring a final concentration of 45 mM. Absorbance at 415 nm was measured on a Microplaque Reader (Bio-Rad 550). Activity was determined considering absorbance of standard series. This experiment is characterized by three assays for each group made twice.

O-GlcNAc transferase and O-GlcNAcase expression.   Skeletal muscles were removed from control Wistar male rats (n = 5) and rats submitted to 28 days of HU (n = 5), weighing ~300 g, anesthetized with pentobarbital sodium (3 mg/kg), and immediately frozen in liquid nitrogen for subsequent mRNA extraction. Isolation of mRNA was performed with a "MicroPolyA Pure" kit (Ambion). cDNAs were then amplified by reverse transcription-coupled polymerase chain reaction ("Titan One step RT-PCR" kit, Roche). Primer design was based on the O-GlcNAc transferase and O-GlcNAcase sequences available for the rat (13, 16). Two different pairs of primers were used: one pair of forward GGGTTAGCTGAGTTGGCACAT and reverse CTGTCCAGCCTTCGACACTGG primers was designed to amplify the O-GlcNAc transferase cDNA transcript of 151 bp, while the second pair of forward AGAGTGAGCGCAACGCCAATC and reverse TTCGGAGCATACAAGTATGTA synthetic oligonucleotides was designed to amplify a O-GlcNAcase sequence of 252 bp. Subsequent separation of the putative cDNAs was performed by gel electrophoresis on 3% agarose Molecular Screening (Roche) for accurate separation. Two oligonucleotide primers, corresponding to the forward primer GGGAATTCCATATGTCAGACACCGAAGAACA and the reverse primer CATGCCATGGTCACTTCCAGCGGCCTCCAAC, were used to amplify the transcript of GAPDH as a control of RNA quantities for each samples. Densitometry analyses were carried out on Quantiscan (Bio-Rad).

Monodimensional immunoblot analysis.   Monodimensional separation of muscular proteins was achieved by SDS-PAGE using a 10% gel. Twenty micrograms of proteins (MicroBCA Protein Assay) were used for these analyses. Electrotransfer was performed on a 0.45-µm nitrocellulose sheet. HSP70 was revealed using specific antibodies (5). After electrotransfer, the membrane was saturated using a solution of 5% nonfat dry milk in Tris-buffered saline (TBS; 15 mM Tris, 140 mM NaCl, 0.05% Tween 20, pH 8.0); primary antibodies (dilution 1:1,000 for anti-HSP70, 1:30,000 for anti-HSP70 in milk-TBS) were incubated 1 h at room temperature. After 5 x 10-min washes, secondary antibodies (dilution 1:10,000 in milk-TBS) were incubated 1 h at room temperature. After 5 x 10-min washes, detection was carried out using the enhanced chemiluminescence Western blotting detection reagents. Densitometry analyses were performed on Quantiscan (Bio-Rad).

Statistical analysis.   Data are expressed as means ± SE. After one-way ANOVA, Student's t-test was used to establish the significance of differences between means in intergroup comparisons. P < 0.05 was regarded as significant.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Variation of total O-GlcNAc level.   The total O-GlcNAc level was determined for slow and fast skeletal muscles, in control conditions and after 14 and 28 days of HU. As illustrated in Fig. 1A, the level of O-GlcNAc in control soleus is significantly higher than in control fast EDL muscle (0.598 ± 0.021 ng of O-GlcNAc for 100 µg of soleus proteins vs. 0.491 ± 0.021 ng O-GlcNAc for 100 µg of EDL proteins). After HU, there is a decrease in the level of O-GlcNAc in soleus muscle, from 0.598 ± 0.021 to 0.526 ± 0.023 and 0.510 ± 0.027 ng of O-GlcNAc for 100 µg proteins at 14 and 28 days of HU, respectively. In contrast, in EDL muscle, the level of O-GlcNAc increases from 0.491 ± 0.021 to 0.593 ± 0.027 and 0.602 ± 0.029 ng of O-GlcNAc for 100 µg of proteins at 14 and 28 days of HU respectively, with these values being significantly different from control and reaching levels similar to those observed in control soleus. A dramatic decrease of muscle weight expressed relative to animal weight is measured for the soleus, corresponding to 40 and 59.6% after 14 and 28 days of HU, respectively, while a nonsignificant decrease is determined for the EDL, even after 28 days of HU (Fig. 1B).

To identify the nature of the glycans, glycoproteins were submitted to reductive beta-elimination after PNGase F treatment, and released glycans were identified by TLC with N-acetyllactosaminitol as a standard. Either after orcinol staining (Fig. 2A) or after tritiated galactose labeling of oligosaccharide using galactosyltransferase and autoradiography (Fig. 2B), a single band corresponding to the N-acetyllactosaminitol standard was revealed, indicating that glycoproteins were restricted to the single O-GlcNAc motif. These control experiments demonstrated that the radioactivity measured by liquid scintillation corresponded to galactose residues, enzymatically transfered to the sole O-GlcNAc residue.


Figure 2
View larger version (84K):
[in this window]
[in a new window]
  		Fig. 2. Thin-layer chromatography of reductive beta-elimination products of muscular glycoproteins. Skeletal muscle proteins (100 µg) were enzymatically modified with [3H]Gal on their O-GlcNAc residues using bovine galactosyltransferase. After labeling, a reductive beta-elimination following enzymatic peptide N-glycosidase treatment was performed to release the O-linked sugars. The labeled sugars were analyzed on thin-layer chromatography and revealed with sulfuric orcinol (A) or by autoradiography (B). A single band corresponding to the N-acetyllactosaminitol (LacNAc) standard was revealed, indicating that glycoproteins were restricted to the single O-GlcNAc motif.

 
Variation of O-GlcNAc enzymes: O-GlcNAc transferase and O-GlcNAcase.   O-GlcNAc enzyme activities were measured in slow soleus muscle and in fast EDL muscle in control conditions as well as after different periods of HU.

As shown in Fig. 3A, the O-GlcNAc transferase activity decreases in soleus, from 10.94 to 9.23 and 8.66 pmol of O-GlcNAc transferred per minute for 100 µg of muscular proteins after 14 and 28 days of HU, respectively. In EDL muscle, the O-GlcNAc transferase activity increases from 7.65 to 8.85 and 9.11 pmol of O-GlcNAc transferred per minute for 100 µg of muscular proteins after 14 and 28 days of HU, respectively.


Figure 3
View larger version (15K):
[in this window]
[in a new window]
  		Fig. 3. Determination of uridine diphospho-N-acetylglucosamine-polypeptide beta-N-acetyl-glucosaminyl transferase (OGT) and N-acetyl-beta-D-glucosaminidase (GlcNAcase) activities in slow SOL and in fast EDL muscles in control conditions and after different periods of HU. A: the OGT activity is expressed in pmol of O-GlcNAc transferred per min for 100 µg of skeletal muscle proteins for different periods of HU. B: the O-GlcNAcase activity is expressed in pmol of released para-nitrophenol (PNP) per min for 100 µg of skeletal muscle proteins for different periods of HU. Data corresponding to duplicate assays are presented as means ± SE; n = 3 for each group. *Significant difference from control (P < 0.05).

 
By opposition to the O-GlcNAc transferase activity, the O-GlcNAcase activity increases in soleus muscle, from 60.91 to 72.80 and 75.27 pmol of released PNP per minute for 100 µg of muscular proteins after 14 and 28 days of HU, respectively (Fig. 3B). O-GlcNAcase activity in EDL muscle increases first from 55.35 to 71.30 pmol of released PNP per minute for 100 µg of muscular proteins after 14 days of HU and to 63.92 pmol of released PNP per minute for 100 µg of muscular proteins after 28 days of HU.

In contrast to the activity of the two enzymes, similar mRNA levels were measured for the O-GlcNAc transferase and the O-GlcNAcase in soleus as well as in EDL muscles (Fig. 4A). No significant variations in the mRNA levels of the O-GlcNAc transferase and the O-GlcNAcase were detected after 28 days of HU in soleus or in EDL (Fig. 4B).


Figure 4
View larger version (26K):
[in this window]
[in a new window]
  		Fig. 4. Analysis of O-GlcNAcase and GlcNAc transferase mRNA level after 28 days of HU. A: PCR analysis of O-GlcNAcase and O-GlcNAc transferase expression in control SOL (lanes 1 and 3) and EDL (lanes 2 and 4), respectively. Values corresponded to DNA ladder in bp. The PCR products sizes are 152 bp (O-GlcNAc transferase) and 252 bp (O-GlcNAcase). B: densitometric analysis of O-GlcNAcase and O-GlcNAc transferase transcript expressions in SOL (solid bars) and EDL (shaded bars) after 28 days of HU related to the control level. The intensity of the signals was normalized according to the GAPDH signal obtained for the same samples and expressed relative to their respective control. Data are presented as means ± SE; n = 5 for each group.

 
Heat shock protein Western blotting.   Western blot was performed using antibodies directed against HSP70. This protein was previously demonstrated to have lectinic property toward the O-GlcNAc motif and was known to increase stress tolerance. The level of HSP70 expression is six times higher in slow soleus muscle than in fast EDL muscle, where the level of HSP70 is very weak (Fig. 5A).

The level of HSP70 is not modified in soleus muscle after 14 or 28 days of HU, whereas it increases by 60% in fast EDL muscle (n = 5, Fig. 5B).


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
Numerous proteins of the skeletal muscle have recently been demonstrated to be O-GlcNAc (3). However, a potential role of this posttranslational modification in the muscle physiology remains to be elucidated. The main result of our data demonstrates concomitant variations in O-GlcNAc levels and the development of atrophy after HU. The activity of O-GlcNAc transferase, which transfers the monosaccharide, is greater in slow muscle than in fast muscle and gives account for the higher O-GlcNAc level measured in slow muscle in control conditions. We found a higher content of O-GlcNAc in EDL and a lower level of O-GlcNAc in soleus muscles after HU compared with controls. These variations in the O-GlcNAc level can be attributed directly to the corresponding activation or inhibition of the two key enzymes involved in the transfer or the removing of the O-GlcNAc moiety. However, similar levels of mRNA expression were measured for O-GlcNAc transferase and O-GlcNAcase in soleus and in EDL muscles in control conditions as well as after 28 days of HU. Therefore, the differences in enzyme activities are not correlated with a difference in the expression of these protein transcripts. O-GlcNAc is found on myriad proteins with a multitude of glycosylation sites. Yet only one gene of O-GlcNAc transferase exists. Indeed, a regulatory process of the O-GlcNAc transferase may exist to confer a temporal and a substrate specificity in response to cellular signals. Posttranslational mechanism could regulate the O-GlcNAc transferase; this enzyme is itself O-GlcNAc modified and is phosphorylated on a tyrosine residue. Accessory proteins could play a role in activity and/or specificity of the O-GlcNAc transferase (13). We can thus assume that the difference in O-GlcNAc transferase activity between slow and fast skeletal muscle, and in extension after HU, could be due to a modulation of its activity by the process described above rather than to a difference in the protein expression.

A lower level of O-GlcNAc measured in soleus muscle is associated with a loss of mass, whereas a higher O-GlcNAc level is observed in the EDL, which is not significantly atrophied. Indeed, a lower O-GlcNAc level in soleus is detectable after 14 days of HU, when atrophy is developed, and sustained after 28 days of HU. It is well known that atrophy is characterized by a decrease in protein content of skeletal muscle fibers (24). Moreover, the activation of the ubiquitin-proteasome pathway in skeletal muscle during disuse atrophy has been reported (10, 11). Numerous reports have demonstrated that O-GlcNAc glycosylation protected against the proteasomal degradation by modifying the target proteins as for the murine estrogen receptor (ER)-beta (1), Sp1 (7), and plakoglobin (8). In fact, major O-GlcNAc sites on both ER-{alpha} and ER-beta are within regions of high PEST (proline, glutamate, serine, and threonine) scores, which have been proposed to be a signal responsible for rapid protein degradation. O-GlcNAc addition at this site might be expected to block rapid degradation, while phosphorylation would convert the locus from a patent PEST signal to a highly active one (1). Proteasome itself has also been demonstrated to be O-GlcNAc modified (29). These data suggest that O-GlcNAc variation might modulate atrophy by regulating the activation of the proteasome pathway.

However, O-GlcNAc variation has also been associated with the oxidative stress. In fact, it has recently been shown that, in cell culture, levels of O-GlcNAc increased rapidly in response to different forms of stress, like heat shock, ethanol, UV, kypoxia, reductive, oxidative, and osmotic stress (28). Blocking or reducing O-GlcNAc increased the sensitivity of cells to stress, causing a decrease in cell survival, whereas an increase of O-GlcNAc level protected cells against stress. Lawler et al. (14) have shown that HU increased oxidative stress related to an imbalance in the antioxidant enzyme system. In this way, a lower O-GlcNAc level, associated with the oxidative stress, may accelerate muscle protein breakdown, as oxidatively modified proteins are more susceptible to proteolytic attack, and produce the development of atrophy after HU. By contrast, a higher O-GlcNAc level will protect the EDL muscle against degradation of proteins and will, therefore, avoid the muscle atrophy.

Mechanism of O-GlcNAc-mediated stress tolerance includes a faster induction of HSP70 and HSP40, as these proteins are known to increase stress tolerance (28). HSP70, which is mainly located in the cytosol and the nucleus of eukaryotic cells, has been reported to be involved in the protection and refolding of normal and damaged proteins. Lectinic property of the HSP70 toward the O-GlcNAc motif was previously demonstrated with a protein extract obtained from the HepG2 human hepatocarcinoma cell line (5). These data suggested that O-GlcNAc influenced protein stability through specific interaction with HSP70 members. A relationship between the HSP70 and muscle atrophy has been previously described, since the attenuation of atrophy in hindlimb-unweighting rat submitted to heat shock before HU was measured (20). Thus it is conceivable that the higher O-GlcNAc glycosylation, together with the increase in the expression of HSP70, which can interact with the O-GlcNAc proteins, will prevent degradation of these proteins by the proteasome and prevent the development of atrophy as it is observed in the EDL. On the contrary, the lower O-GlcNAc level will allow the degradation of proteins and the mass loss observed in the atrophied muscle. We can note that the level of HSP70 is higher in slow soleus muscle than in fast EDL muscle. Locke et al. (17) have shown that HSP72 is expressed constitutively in unstressed rat muscle composed essentially of type I fibers. They suggested that increased levels of HSP72 in slow-oxidative muscle could be related to the fact that type I fibers in slow muscle are continuously subjected to a more stressful environment than other fiber types and require the function of HSP72. Thus the higher expression of HSP70 in soleus muscle than in EDL can be attributed to the oxidative metabolism of the soleus muscle. However, HSP70 level was not modified in soleus muscle after HU, even when the oxidative stress increased after HU. We can suppose that, in these conditions, slow muscle is not able to counteract the increase in protein degradation at the origin of muscular atrophy.

Finally, our data demonstrate that variation in the O-GlcNAc level can be associated with the development of muscular atrophy. These results suggest that O-GlcNAc posttranslational modification may be linked to the control of muscle protein homeostasis.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by the Centre National de la Recherche Scientifique (CNRS)/Unité Mixte de Service 8576, the Institut Fédératif de Recherche 118, and the Centre National d'Etudes Spatiales (CNES, no. 3194–2002). The Proteomics facility used in this study was founded by the European Community (FEDER), the Région Nord-Pas-de-Calais (France), the CNRS, the Génopôle of Lille, and the Université des Sciences et Technologies de Lille. C. Cieniewski-Bernard is a recipient of a fellowship from the Fondation pour la Recherche Médicale.


   FOOTNOTES
 

Address for reprint requests and other correspondence: B. Bastide, Laboratoire de Plasticité Neuromusculaire, EA1032, IFR118, Université des Sciences et Technologies de Lille, 59655 Villeneuve d'Ascq Cedex, France (e-mail: bruno.bastide{at}univ-lille1.fr)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Cheng X, Cole RN, Zaia J, and Hart GW. Alternative O-glycosylation/O-phosphorylation of the murine estrogen receptor beta. Biochemistry 39: 11609–11620, 2000.[CrossRef][Medline]
  2. Chou TY, Hart GW, and Dang CV. c-Myc is glycosylated at threonine 58, a known phosphorylation site and a mutational hot spot in lymphomas. J Biol Chem 270: 18961–18965, 1995.[Abstract/Free Full Text]
  3. Cieniewski-Bernard C, Bastide B, Lefebvre T, Lemoine J, Mounier Y, and Michalski JC. Identification of O-linked N-acetylglucosamine proteins in rat skeletal muscle using two-dimensional gel electrophoresis and mass spectrometry. Mol Cell Proteomics 3: 577–585, 2004.[Abstract/Free Full Text]
  4. Dong DL and Hart GW. Purification and characterization of an O-GlcNAc selective N-acetyl-beta-D-glucosaminidase from rat spleen cytosol. J Biol Chem 269: 19321–19330, 1994.[Abstract/Free Full Text]
  5. Guinez C, Lemoine J, Michalski JC, and Lefebvre T. 70-kDa-heat shock protein presents an adjustable lectinic activity towards O-linked N-acetylglucosamine. Biochem Biophys Res Commun 319: 21–26, 2004.[CrossRef][ISI][Medline]
  6. Haltiwanger RS, Holt GD, and Hart GW. Enzymatic addition of O-GlcNAc to nuclear and cytoplasmic proteins. Identification of a uridine diphospho-N-acetylglucosamine: peptide beta-N-acetylglucosaminyltransferase. J Biol Chem 265: 2563–2568, 1990.[Abstract/Free Full Text]
  7. Han I and Kudlow JE. Reduced O-glycosylation of Sp1 is associated with increased proteasome susceptibility. Mol Cell Biol 17: 2550–2558, 1997.[Abstract]
  8. Hatsell S, Medina L, Merola J, Haltiwanger R, and Cowin P. Plakoglobin is O-glycosylated close to the N-terminal destruction box. J Biol Chem 278: 37745–37752, 2003.[Abstract/Free Full Text]
  9. Holt GD and Hart GW. The subcellular distribution of terminal N-acetylglucosamine moieties. Localization of a novel protein-saccharide linkage, O-linked GlcNAc. J Biol Chem 261: 8049–8057, 1986.[Abstract/Free Full Text]
  10. Hunter RB, Stevenson E, Koncarevic A, Mitchell-Felton H, Essig DA, and Kandarian SC. Activation of an alternative NF-kappaB pathway in skeletal muscle during disuse atrophy. FASEB J 16: 529–538, 2002.[Abstract/Free Full Text]
  11. Ikemoto M, Nikawa T, Takeda S, Watanabe C, Kitano T, Baldwin KM, Izumi R, Nonaka I, Towatari T, Teshima S, Rokutan K, and Kishi K. Space shuttle flight (STS-90) enhances degradation of rat myosin heavy chain in association with activation of ubiquitin-proteasome pathway. FASEB J 15: 1279–1281, 2001.[Free Full Text]
  12. Kelly WG, Dahmus ME, and Hart GW. RNA polymerase II is a glycoprotein. Modification of the COOH-terminal domain by O-GlcNAc. J Biol Chem 268: 10416–10424, 1993.[Abstract/Free Full Text]
  13. Kreppel LK, Blomberg MA, and Hart GW. Dynamic glycosylation of nuclear and cytosolic proteins. Cloning and characterization of a unique O-GlcNAc transferase with multiple tetratricopeptide repeats. J Biol Chem 272: 9308–9315, 1997.[Abstract/Free Full Text]
  14. Lawler JM, Song W, and Demaree SR. Hindlimb unloading increases oxidative stress and disrupts antioxidant capacity in skeletal muscle. Free Radic Biol Med 35: 9–16, 2003.[CrossRef][ISI][Medline]
  15. Lefebvre T, Alonso C, Mahboub S, Dupire MJ, Zanetta JP, Caillet-Boudin ML, and Michalski JC. Effect of okadaic acid on O-linked N-acetylglucosamine levels in a neuroblastoma cell line. Biochim Biophys Acta 1472: 71–81, 1999.[Medline]
  16. Liu K, Paterson AJ, Konrad RJ, Parlow AF, Jimi S, Roh M, Chin E, and Kudlow JE. Streptozotocin, an O-GlcNAcase inhibitor, blunts insulin and growth hormone secretion. Mol Cell Endocrinol 194: 135–146, 2002.[CrossRef][ISI][Medline]
  17. Locke M, Noble EG, and Atkinson BG. Inducible isoform of HSP70 is constitutively expressed in a muscle fiber type specific pattern. Am J Physiol Cell Physiol 261: C774–C779, 1991.[Abstract/Free Full Text]
  18. MacDonald KS and Fitts RH. Effect of hindlimb unloading on rat soleus fiber force, stiffness, and calcium sensitivity. J Appl Physiol 79: 1796–1802, 1995.[Abstract/Free Full Text]
  19. Morey ER, Sabelman EE, Turner RT, and Baylink DJ. A new rat model simulating some aspects of space flight. Physiologist 22: S23–S24, 1979.[Medline]
  20. Naito H, Powers SK, Demirel HA, Sugiura T, Dodd SL, and Aoki J. Heat stress attenuates skeletal muscle atrophy in hindlimb-unweighted rats. J Appl Physiol 88: 359–363, 2000.[Abstract/Free Full Text]
  21. Roquemore EP, Chevrier MR, Cotter RJ, and Hart GW. Dynamic O-GlcNAcylation of the small heat shock protein alpha B-crystallin. Biochemistry 35: 3578–3586, 1996.[CrossRef][Medline]
  22. Roquemore EP, Chou TY, and Hart GW. Detection of O-linked N-acetylglucosamine (O-GlcNAc) on cytoplasmic and nuclear proteins. Methods Enzymol 230: 443–460, 1994.[ISI][Medline]
  23. Sumegi M, Hunyadi-Gulyas E, Medzihradszky KF, and Udvardy A. 26S proteasome subunits are O-linked N-acetylglucosamine-modified in Drosophila melanogaster. Biochem Biophys Res Commun 312: 1284–1289, 2003.[CrossRef][ISI][Medline]
  24. Thomason DB and Booth FW. Atrophy of the soleus muscle by hindlimb unweighting. J Appl Physiol 68: 1–12, 1990.[Abstract/Free Full Text]
  25. Torres CR and Hart GW. Topography and polypeptide distribution of terminal N-acetylglucosamine residues on the surfaces of intact lymphocytes. Evidence for O-linked GlcNAc. J Biol Chem 259: 3308–3317, 1984.[Abstract/Free Full Text]
  26. Wells L, Vosseler K, and Hart GW. A role for N-acetylglucosamine as a nutrient sensor and mediator of insulin resistance. Cell Mol Life Sci 60: 222–228, 2003.[CrossRef][ISI][Medline]
  27. Yki-Järvinen H, Virkamaki A, Daniels MC, McClain D, and Gottschalk WR. Insulin and glucosamine infusions increase O-linked N-acetyl-glucosamine in skeletal muscle proteins in vivo. Metabolism 47: 449–455, 1998.[CrossRef][ISI][Medline]
  28. Zachara NF, O'Donnell N, Cheung WM, Mercer JJ, Marth JD, and Hart GW. Dynamic O-GlcNAc modification of nucleocytoplasmic proteins in response to stress. A survival response of mammalian cells. J Biol Chem 279: 30133–30142, 2004.[Abstract/Free Full Text]
  29. Zhang F, Su K, Yang X, Bowe DB, Paterson AJ, and Kudlow JE. O-GlcNAc modification is an endogenous inhibitor of the proteasome. Cell 115: 715–725, 2003.[CrossRef][ISI][Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
J. Hedou, C. Cieniewski-Bernard, Y. Leroy, J.-C. Michalski, Y. Mounier, and B. Bastide
O-Linked N-Acetylglucosaminylation Is Involved in the Ca2+ Activation Properties of Rat Skeletal Muscle
J. Biol. Chem., April 6, 2007; 282(14): 10360 - 10369.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
N. Fulop, M. M. Mason, K. Dutta, P. Wang, A. J. Davidoff, R. B. Marchase, and J. C. Chatham
Impact of Type 2 diabetes and aging on cardiomyocyte function and O-linked N-acetylglucosamine levels in the heart
Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1370 - C1378.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
100/5/1499    most recent
00865.2005v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cieniewski-Bernard, C.
Right arrow Articles by Bastide, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cieniewski-Bernard, C.
Right arrow Articles by Bastide, B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.